EMAIL THIS PAGE TO A FRIEND

CD46

CD46 molecule, complement regulatory protein

213 Gene Product Result for
Synonyms: AHUS2 MCP MIC10 TLX TRA2.10
Gene ID:
Human(4179) Summary: The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]
Mouse(17221) CD46 antigen, complement regulatory protein
Rat(29333) CD46 molecule, complement regulatory protein
dog(609365) CD46 molecule, complement regulatory protein
domestic cat(101094152) CD46 molecule, complement regulatory protein
cow(280851) CD46 molecule, complement regulatory protein
cow(616002) CD46 molecule, complement regulatory protein
domestic guinea pig(100135498) CD46 antigen, complement regulatory protein
naked mole-rat(101704640) CD46 molecule, complement regulatory protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA016903 Anti-CD46 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1408602 Anti-CD46, (N-terminal) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1404058 Monoclonal Anti-CD46 antibody produced in mouse clone 1B6, ascites fluid human
ELISA, western blot pricing
SAB4700428 Monoclonal Anti-CD46 antibody produced in mouse clone MEM-258, purified immunoglobulin, buffered aqueous solution bovine, human
flow cytometry pricing
SAB4700427 Monoclonal Anti-CD46 azide free antibody produced in mouse clone MEM-258, purified immunoglobulin, buffered aqueous solution human, bovine
flow cytometry pricing
SAB4700429 Monoclonal Anti-CD46-APC antibody produced in mouse clone MEM-258, purified immunoglobulin, buffered aqueous solution human, bovine
flow cytometry pricing
SAB4700430 Monoclonal Anti-CD46-Biotin antibody produced in mouse clone MEM-258, purified immunoglobulin, buffered aqueous solution bovine, human
flow cytometry pricing
SAB4700431 Monoclonal Anti-CD46-FITC antibody produced in mouse clone MEM-258, purified immunoglobulin, buffered aqueous solution human, bovine
flow cytometry pricing
SAB4700432 Monoclonal Anti-CD46-PE antibody produced in mouse clone MEM-258, purified immunoglobulin, buffered aqueous solution bovine, human
flow cytometry pricing
WH0004179M7 Monoclonal Anti-MCP antibody produced in mouse clone 2E10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

ELISA

Product # Description Species Add to Cart
 
RAB1341 Human CD46 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002389 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114701 MISSION® esiRNA esiRNA human CD46 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002389 Rosetta Predictions human pricing
NM_153826 Rosetta Predictions human pricing
NM_172350 Rosetta Predictions human pricing
NM_172351 Rosetta Predictions human pricing
NM_172352 Rosetta Predictions human pricing
NM_172353 Rosetta Predictions human pricing
NM_172354 Rosetta Predictions human pricing
NM_172355 Rosetta Predictions human pricing
NM_172356 Rosetta Predictions human pricing
NM_172357 Rosetta Predictions human pricing
NM_172358 Rosetta Predictions human pricing
NM_172359 Rosetta Predictions human pricing
NM_172360 Rosetta Predictions human pricing
NM_172361 Rosetta Predictions human pricing
NM_019190 Rosetta Predictions rat pricing
NM_010778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041782 predicted 505
2 SASI_Hs01_00041783 predicted 383
3 SASI_Hs01_00041784 predicted 1605
4 SASI_Hs01_00041785 predicted 494
5 SASI_Hs02_00333745 predicted 1596
6 SASI_Hs01_00041786 predicted 326
7 SASI_Hs01_00041788 predicted 494
8 SASI_Hs01_00041789 predicted 680
9 SASI_Hs01_00041790 predicted 1588
10 SASI_Hs01_00041791 predicted 504
11 SASI_Hs01_00041787 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014163 predicted 514
2 SASI_Hs01_00014164 predicted 377
3 SASI_Hs01_00014165 predicted 1465
4 SASI_Hs01_00014166 predicted 493
5 SASI_Hs01_00014167 predicted 1456
6 SASI_Hs01_00014168 predicted 328
7 SASI_Hs01_00014170 predicted 502
8 SASI_Hs01_00014171 predicted 683
9 SASI_Hs01_00014172 predicted 1507
10 SASI_Hs02_00367509 predicted 507
11 SASI_Hs01_00014169 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081366 predicted 510
2 SASI_Hs01_00081367 predicted 379
3 SASI_Hs01_00081368 predicted 1357
4 SASI_Hs01_00081369 predicted 491
5 SASI_Hs01_00081370 predicted 1346
6 SASI_Hs01_00081371 predicted 331
7 SASI_Hs01_00081373 predicted 502
8 SASI_Hs01_00081374 predicted 680
9 SASI_Hs01_00081375 predicted 1393
10 SASI_Hs02_00367998 predicted 510
11 SASI_Hs01_00081372 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011638 predicted 506
2 SASI_Hs01_00011639 predicted 376
3 SASI_Hs01_00011640 predicted 1563
4 SASI_Hs01_00011641 predicted 496
5 SASI_Hs02_00367999 predicted 1554
6 SASI_Hs01_00011642 predicted 322
7 SASI_Hs01_00011644 predicted 502
8 SASI_Hs01_00011645 predicted 675
9 SASI_Hs01_00011647 predicted 512
10 SASI_Hs02_00368000 predicted 445
11 SASI_Hs01_00011643 predicted 317
12 SASI_Hs01_00011646 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147862 predicted 508
2 SASI_Hs01_00147863 predicted 383
3 SASI_Hs01_00147864 predicted 1514
4 SASI_Hs01_00147865 predicted 493
5 SASI_Hs02_00368001 predicted 1509
6 SASI_Hs01_00147866 predicted 331
7 SASI_Hs01_00147868 predicted 501
8 SASI_Hs01_00147869 predicted 675
9 SASI_Hs01_00147870 predicted 1491
10 SASI_Hs01_00147871 predicted 511
11 SASI_Hs01_00147867 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032879 predicted 505
2 SASI_Hs01_00032880 predicted 376
3 SASI_Hs01_00032881 predicted 1421
4 SASI_Hs01_00032882 predicted 491
5 SASI_Hs01_00032883 predicted 1410
6 SASI_Hs01_00032884 predicted 322
7 SASI_Hs01_00032886 predicted 493
8 SASI_Hs01_00032887 predicted 679
9 SASI_Hs01_00032888 predicted 1455
10 SASI_Hs02_00368002 predicted 511
11 SASI_Hs01_00032885 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241196 predicted 510
2 SASI_Hs01_00241197 predicted 381
3 SASI_Hs01_00241198 predicted 1566
4 SASI_Hs01_00241199 predicted 491
5 SASI_Hs02_00368003 predicted 1556
6 SASI_Hs01_00241200 predicted 329
7 SASI_Hs01_00241202 predicted 496
8 SASI_Hs01_00241203 predicted 676
9 SASI_Hs01_00241204 predicted 1545
10 SASI_Hs01_00241205 predicted 507
11 SASI_Hs01_00241201 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223793 predicted 510
2 SASI_Hs01_00223794 predicted 383
3 SASI_Hs01_00223795 predicted 1515
4 SASI_Hs01_00223796 predicted 491
5 SASI_Hs02_00368004 predicted 1509
6 SASI_Hs01_00223797 predicted 323
7 SASI_Hs01_00223799 predicted 496
8 SASI_Hs01_00223800 predicted 678
9 SASI_Hs01_00223802 predicted 505
10 SASI_Hs02_00368005 predicted 452
11 SASI_Hs01_00223798 predicted 316
12 SASI_Hs01_00223801 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065310 predicted 505
2 SASI_Hs01_00065311 predicted 383
3 SASI_Hs01_00065312 predicted 1426
4 SASI_Hs01_00065314 predicted 499
5 SASI_Hs01_00065315 predicted 1412
6 SASI_Hs01_00065316 predicted 330
7 SASI_Hs01_00065318 predicted 497
8 SASI_Hs01_00065319 predicted 679
9 SASI_Hs02_00368006 predicted 1461
10 SASI_Hs02_00368007 predicted 505
11 SASI_Hs01_00065313 predicted 1411
12 SASI_Hs01_00065317 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203094 predicted 505
2 SASI_Hs01_00203095 predicted 383
3 SASI_Hs01_00203096 predicted 1472
4 SASI_Hs01_00203097 predicted 499
5 SASI_Hs02_00368008 predicted 1466
6 SASI_Hs01_00203098 predicted 325
7 SASI_Hs01_00203100 predicted 500
8 SASI_Hs01_00203101 predicted 684
9 SASI_Hs01_00203102 predicted 1456
10 SASI_Hs01_00203103 predicted 513
11 SASI_Hs01_00203099 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144347 predicted 514
2 SASI_Hs01_00144348 predicted 378
3 SASI_Hs01_00144349 predicted 1435
4 SASI_Hs01_00144350 predicted 491
5 SASI_Hs01_00144351 predicted 1419
6 SASI_Hs01_00144352 predicted 325
7 SASI_Hs01_00144354 predicted 498
8 SASI_Hs01_00144355 predicted 683
9 SASI_Hs01_00144356 predicted 1468
10 SASI_Hs02_00368009 predicted 507
11 SASI_Hs01_00144353 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109642 predicted 514
2 SASI_Hs01_00109643 predicted 377
3 SASI_Hs01_00109644 predicted 1513
4 SASI_Hs01_00109645 predicted 492
5 SASI_Hs01_00109646 predicted 1500
6 SASI_Hs01_00109647 predicted 323
7 SASI_Hs01_00109649 predicted 500
8 SASI_Hs01_00109650 predicted 675
9 SASI_Hs01_00109651 predicted 1545
10 SASI_Hs02_00368010 predicted 510
11 SASI_Hs01_00109648 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036596 predicted 508
2 SASI_Hs01_00036597 predicted 379
3 SASI_Hs01_00036598 predicted 1469
4 SASI_Hs01_00036599 predicted 496
5 SASI_Hs01_00036600 predicted 1459
6 SASI_Hs01_00036601 predicted 330
7 SASI_Hs01_00036603 predicted 497
8 SASI_Hs01_00036604 predicted 675
9 SASI_Hs01_00036605 predicted 1503
10 SASI_Hs02_00368011 predicted 506
11 SASI_Hs01_00036602 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239293 predicted 510
2 SASI_Hs01_00239294 predicted 382
3 SASI_Hs01_00239295 predicted 1380
4 SASI_Hs01_00239296 predicted 499
5 SASI_Hs01_00239297 predicted 1368
6 SASI_Hs01_00239298 predicted 325
7 SASI_Hs01_00239300 predicted 498
8 SASI_Hs01_00239301 predicted 681
9 SASI_Hs01_00239302 predicted 1419
10 SASI_Hs02_00368012 predicted 508
11 SASI_Hs01_00239299 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101855 predicted 206
2 SASI_Rn01_00101856 predicted 358
3 SASI_Rn01_00101857 predicted 205
4 SASI_Rn01_00101858 predicted 403
5 SASI_Rn01_00101859 predicted 416
6 SASI_Rn01_00101860 predicted 275
7 SASI_Rn01_00101861 predicted 291
8 SASI_Rn01_00101862 predicted 288
9 SASI_Rn01_00101863 predicted 286
10 SASI_Rn01_00101864 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083696 predicted 730
2 SASI_Mm02_00319328 predicted 975
3 SASI_Mm02_00319329 predicted 474
4 SASI_Mm01_00083697 predicted 650
5 SASI_Mm01_00083698 predicted 942
6 SASI_Mm01_00083700 predicted 320
7 SASI_Mm01_00083701 predicted 731
8 SASI_Mm01_00083702 predicted 799
9 SASI_Mm01_00083703 predicted 433
10 SASI_Mm01_00083704 predicted 379
11 SASI_Mm01_00083699 predicted 936
12 SASI_Mm01_00083705 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010778
CD46 MISSION shRNA Bacterial Glycerol Stock
CD46 molecule, complement regulatory protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010778.3-996s21c1
Sequence:CCGGGAATTAGATGCATGGATTATTCTCGAGAATAATCCATGCATCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010778.3-772s21c1
Sequence:CCGGTATCAGGAGCTGGCGAAATATCTCGAGATATTTCGCCAGCTCCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-613s1c1
Sequence:CCGGGCAGTAAGTTACAGTTGTGATCTCGAGATCACAACTGTAACTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-68s1c1
Sequence:CCGGGCAGAAGGAAGAGCTACACTTCTCGAGAAGTGTAGCTCTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-366s1c1
Sequence:CCGGCCCTTCATTTGGCAAAGTATACTCGAGTATACTTTGCCAAATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-798s1c1
Sequence:CCGGCTATCAATCAACAGTGATGTTCTCGAGAACATCACTGTTGATTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-328s1c1
Sequence:CCGGGCTGGTTGTATTAAAGTTCAACTCGAGTTGAACTTTAATACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010778
CD46 MISSION shRNA shRNA Plasmid DNA
CD46 molecule, complement regulatory protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010778.3-996s21c1
Sequence:CCGGGAATTAGATGCATGGATTATTCTCGAGAATAATCCATGCATCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010778.3-772s21c1
Sequence:CCGGTATCAGGAGCTGGCGAAATATCTCGAGATATTTCGCCAGCTCCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-613s1c1
Sequence:CCGGGCAGTAAGTTACAGTTGTGATCTCGAGATCACAACTGTAACTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-68s1c1
Sequence:CCGGGCAGAAGGAAGAGCTACACTTCTCGAGAAGTGTAGCTCTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-366s1c1
Sequence:CCGGCCCTTCATTTGGCAAAGTATACTCGAGTATACTTTGCCAAATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-798s1c1
Sequence:CCGGCTATCAATCAACAGTGATGTTCTCGAGAACATCACTGTTGATTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-328s1c1
Sequence:CCGGGCTGGTTGTATTAAAGTTCAACTCGAGTTGAACTTTAATACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010778
CD46 MISSION shRNA Lentiviral Transduction Particles
CD46 molecule, complement regulatory protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010778.3-996s21c1
Sequence:CCGGGAATTAGATGCATGGATTATTCTCGAGAATAATCCATGCATCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010778.3-772s21c1
Sequence:CCGGTATCAGGAGCTGGCGAAATATCTCGAGATATTTCGCCAGCTCCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-613s1c1
Sequence:CCGGGCAGTAAGTTACAGTTGTGATCTCGAGATCACAACTGTAACTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-68s1c1
Sequence:CCGGGCAGAAGGAAGAGCTACACTTCTCGAGAAGTGTAGCTCTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-366s1c1
Sequence:CCGGCCCTTCATTTGGCAAAGTATACTCGAGTATACTTTGCCAAATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-798s1c1
Sequence:CCGGCTATCAATCAACAGTGATGTTCTCGAGAACATCACTGTTGATTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010778.2-328s1c1
Sequence:CCGGGCTGGTTGTATTAAAGTTCAACTCGAGTTGAACTTTAATACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002389
VALIDATED
CD46 MISSION shRNA Bacterial Glycerol Stock
CD46 molecule, complement regulatory protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002389.3-2105s21c1
Sequence:CCGGATCCCTAACTGATCGAATATACTCGAGTATATTCGATCAGTTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002389.3-763s21c1
Sequence:CCGGATTGGAGAGAGCACGATTTATCTCGAGATAAATCGTGCTCTCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002389.3-321s21c1
Sequence:CCGGGATTGGTGAACGAGTAGATTACTCGAGTAATCTACTCGTTCACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002389.3-374s21c1
Sequence:CCGGCTCTTGCCACCCATACTATTTCTCGAGAAATAGTATGGGTGGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002389.3-817s1c1
Sequence:CCGGCCAGAGTGTAAAGTGGTCAAACTCGAGTTTGACCACTTTACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002389.3-712s1c1
Sequence:CCGGGCAGTAACTTATAGTTGTGATCTCGAGATCACAACTATAAGTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002389.3-267s1c1
Sequence:CCGGGCCACCAACATTTGAAGCTATCTCGAGATAGCTTCAAATGTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002389.3-384s1c1
Sequence:CCGGCCATACTATTTGTGATCGGAACTCGAGTTCCGATCACAAATAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002389
VALIDATED
CD46 MISSION shRNA shRNA Plasmid DNA
CD46 molecule, complement regulatory protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002389.3-2105s21c1
Sequence:CCGGATCCCTAACTGATCGAATATACTCGAGTATATTCGATCAGTTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002389.3-763s21c1
Sequence:CCGGATTGGAGAGAGCACGATTTATCTCGAGATAAATCGTGCTCTCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002389.3-321s21c1
Sequence:CCGGGATTGGTGAACGAGTAGATTACTCGAGTAATCTACTCGTTCACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002389.3-374s21c1
Sequence:CCGGCTCTTGCCACCCATACTATTTCTCGAGAAATAGTATGGGTGGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002389.3-817s1c1
Sequence:CCGGCCAGAGTGTAAAGTGGTCAAACTCGAGTTTGACCACTTTACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002389.3-712s1c1
Sequence:CCGGGCAGTAACTTATAGTTGTGATCTCGAGATCACAACTATAAGTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002389.3-267s1c1
Sequence:CCGGGCCACCAACATTTGAAGCTATCTCGAGATAGCTTCAAATGTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002389.3-384s1c1
Sequence:CCGGCCATACTATTTGTGATCGGAACTCGAGTTCCGATCACAAATAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002389
VALIDATED
CD46 MISSION shRNA Lentiviral Transduction Particles
CD46 molecule, complement regulatory protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002389.3-2105s21c1
Sequence:CCGGATCCCTAACTGATCGAATATACTCGAGTATATTCGATCAGTTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002389.3-763s21c1
Sequence:CCGGATTGGAGAGAGCACGATTTATCTCGAGATAAATCGTGCTCTCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002389.3-321s21c1
Sequence:CCGGGATTGGTGAACGAGTAGATTACTCGAGTAATCTACTCGTTCACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002389.3-374s21c1
Sequence:CCGGCTCTTGCCACCCATACTATTTCTCGAGAAATAGTATGGGTGGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002389.3-817s1c1
Sequence:CCGGCCAGAGTGTAAAGTGGTCAAACTCGAGTTTGACCACTTTACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002389.3-712s1c1
Sequence:CCGGGCAGTAACTTATAGTTGTGATCTCGAGATCACAACTATAAGTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002389.3-267s1c1
Sequence:CCGGGCCACCAACATTTGAAGCTATCTCGAGATAGCTTCAAATGTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002389.3-384s1c1
Sequence:CCGGCCATACTATTTGTGATCGGAACTCGAGTTCCGATCACAAATAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks