EMAIL THIS PAGE TO A FRIEND

CD47

CD47 molecule

321 Gene Product Result for
Synonyms: IAP MER6 OA3
UniProtKB ID: Q08722, A8K198, D3DN59, Q53Y71, Q96A60
Gene ID:
Human(961) Summary: This gene encodes a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. The encoded protein is also a receptor for the C-terminal cell binding domain of thrombospondin, and it may play a role in membrane transport and signal transduction. This gene has broad tissue distribution, and is reduced in expression on Rh erythrocytes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(16423) CD47 antigen (Rh-related antigen, integrin-associated signal transducer)
Rat(29364) Cd47 molecule
chicken(418408) CD47 molecule
cow(282661) CD47 molecule
domestic cat(101083027) CD47 molecule
dog(478552) CD47 molecule
sheep(101111153) CD47 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1342 Human CD47 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001777 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010581 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010581 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010581 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068161 MISSION® esiRNA esiRNA human CD47 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025079 Rosetta Predictions human pricing
NM_001777 Rosetta Predictions human pricing
NM_198793 Rosetta Predictions human pricing
NM_019195 Rosetta Predictions rat pricing
NM_010581 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307324 predicted 819
2 SASI_Hs01_00048200 predicted 1589
3 SASI_Hs01_00048201 predicted 1496
4 SASI_Hs01_00048203 predicted 543
5 SASI_Hs01_00048204 predicted 378
6 SASI_Hs01_00048205 predicted 1575
7 SASI_Hs01_00048206 predicted 466
8 SASI_Hs01_00048207 predicted 1448
9 SASI_Hs01_00048208 predicted 1574
10 SASI_Hs01_00048209 predicted 1480
11 SASI_Hs01_00048202 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332529 predicted 813
2 SASI_Hs01_00091285 predicted 1616
3 SASI_Hs01_00091286 predicted 1526
4 SASI_Hs01_00091288 predicted 540
5 SASI_Hs01_00091289 predicted 373
6 SASI_Hs01_00091290 predicted 1608
7 SASI_Hs01_00091291 predicted 458
8 SASI_Hs01_00091292 predicted 1485
9 SASI_Hs01_00091293 predicted 1614
10 SASI_Hs01_00091294 predicted 1515
11 SASI_Hs01_00091287 predicted 1361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372321 predicted 820
2 SASI_Hs01_00201451 predicted 1561
3 SASI_Hs01_00201452 predicted 1462
4 SASI_Hs01_00201454 predicted 547
5 SASI_Hs01_00201455 predicted 370
6 SASI_Hs01_00201456 predicted 1542
7 SASI_Hs01_00201457 predicted 457
8 SASI_Hs01_00201458 predicted 1423
9 SASI_Hs01_00201459 predicted 1550
10 SASI_Hs01_00201460 predicted 1448
11 SASI_Hs01_00201453 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101816 predicted 801
2 SASI_Rn01_00101817 predicted 932
3 SASI_Rn01_00101818 predicted 285
4 SASI_Rn01_00101819 predicted 1001
5 SASI_Rn01_00101820 predicted 615
6 SASI_Rn01_00101821 predicted 1118
7 SASI_Rn01_00101822 predicted 740
8 SASI_Rn02_00262013 predicted 1060
9 SASI_Rn01_00101823 predicted 749
10 SASI_Rn01_00101824 predicted 980
11 SASI_Rn01_00101815 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116900 predicted 884
2 SASI_Mm01_00116901 predicted 1009
3 SASI_Mm01_00116902 predicted 1029
4 SASI_Mm01_00116903 predicted 566
5 SASI_Mm01_00116904 predicted 471
6 SASI_Mm01_00116905 predicted 300
7 SASI_Mm01_00116906 predicted 573
8 SASI_Mm01_00116907 predicted 698
9 SASI_Mm01_00116908 predicted 849
10 SASI_Mm01_00116909 predicted 1033
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001777
VALIDATED
CD47 MISSION shRNA Bacterial Glycerol Stock
CD47 molecule
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001777.2-1494s1c1
Sequence:CCGGCCTGGTGATTACCCAGAGATACTCGAGTATCTCTGGGTAATCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001777.2-988s1c1
Sequence:CCGGGCACAATTACTTGGACTAGTTCTCGAGAACTAGTCCAAGTAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001777.2-274s1c1
Sequence:CCGGGTTACTAATATGGAGGCACAACTCGAGTTGTGCCTCCATATTAGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001777.2-1024s1c1
Sequence:CCGGGCTTCCAATCAGAAGACTATACTCGAGTATAGTCTTCTGATTGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001777.2-773s1c1
Sequence:CCGGGCCTTGGTTTAATTGTGACTTCTCGAGAAGTCACAATTAAACCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001777.3-227s21c1
Sequence:CCGGGATCAGCTCAGCTACTATTTACTCGAGTAAATAGTAGCTGAGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001777.3-1172s21c1
Sequence:CCGGTCCGATTTGGAGAGTAGTAAGCTCGAGCTTACTACTCTCCAAATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001777.3-1057s21c1
Sequence:CCGGGCTTCCAATCAGAAGACTATACTCGAGTATAGTCTTCTGATTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001777.3-806s21c1
Sequence:CCGGGCCTTGGTTTAATTGTGACTTCTCGAGAAGTCACAATTAAACCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001777.3-1021s21c1
Sequence:CCGGGCACAATTACTTGGACTAGTTCTCGAGAACTAGTCCAAGTAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001777
VALIDATED
CD47 MISSION shRNA shRNA Plasmid DNA
CD47 molecule
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001777.2-1494s1c1
Sequence:CCGGCCTGGTGATTACCCAGAGATACTCGAGTATCTCTGGGTAATCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001777.2-988s1c1
Sequence:CCGGGCACAATTACTTGGACTAGTTCTCGAGAACTAGTCCAAGTAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001777.2-274s1c1
Sequence:CCGGGTTACTAATATGGAGGCACAACTCGAGTTGTGCCTCCATATTAGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001777.2-1024s1c1
Sequence:CCGGGCTTCCAATCAGAAGACTATACTCGAGTATAGTCTTCTGATTGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001777.2-773s1c1
Sequence:CCGGGCCTTGGTTTAATTGTGACTTCTCGAGAAGTCACAATTAAACCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001777.3-227s21c1
Sequence:CCGGGATCAGCTCAGCTACTATTTACTCGAGTAAATAGTAGCTGAGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001777.3-1172s21c1
Sequence:CCGGTCCGATTTGGAGAGTAGTAAGCTCGAGCTTACTACTCTCCAAATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001777.3-1057s21c1
Sequence:CCGGGCTTCCAATCAGAAGACTATACTCGAGTATAGTCTTCTGATTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001777.3-806s21c1
Sequence:CCGGGCCTTGGTTTAATTGTGACTTCTCGAGAAGTCACAATTAAACCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001777.3-1021s21c1
Sequence:CCGGGCACAATTACTTGGACTAGTTCTCGAGAACTAGTCCAAGTAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001777
VALIDATED
CD47 MISSION shRNA Lentiviral Transduction Particles
CD47 molecule
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001777.2-1494s1c1
Sequence:CCGGCCTGGTGATTACCCAGAGATACTCGAGTATCTCTGGGTAATCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001777.2-988s1c1
Sequence:CCGGGCACAATTACTTGGACTAGTTCTCGAGAACTAGTCCAAGTAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001777.2-274s1c1
Sequence:CCGGGTTACTAATATGGAGGCACAACTCGAGTTGTGCCTCCATATTAGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001777.2-1024s1c1
Sequence:CCGGGCTTCCAATCAGAAGACTATACTCGAGTATAGTCTTCTGATTGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001777.2-773s1c1
Sequence:CCGGGCCTTGGTTTAATTGTGACTTCTCGAGAAGTCACAATTAAACCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001777.3-227s21c1
Sequence:CCGGGATCAGCTCAGCTACTATTTACTCGAGTAAATAGTAGCTGAGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001777.3-1172s21c1
Sequence:CCGGTCCGATTTGGAGAGTAGTAAGCTCGAGCTTACTACTCTCCAAATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001777.3-1057s21c1
Sequence:CCGGGCTTCCAATCAGAAGACTATACTCGAGTATAGTCTTCTGATTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001777.3-806s21c1
Sequence:CCGGGCCTTGGTTTAATTGTGACTTCTCGAGAAGTCACAATTAAACCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001777.3-1021s21c1
Sequence:CCGGGCACAATTACTTGGACTAGTTCTCGAGAACTAGTCCAAGTAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010581
VALIDATED
CD47 MISSION shRNA Bacterial Glycerol Stock
CD47 molecule
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010581.3-1767s1c1
Sequence:CCGGCCCGTTCTGCTACTTTGATTTCTCGAGAAATCAAAGTAGCAGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010581.3-1031s1c1
Sequence:CCGGGCAGAACTACTTGGATTAGTTCTCGAGAACTAATCCAAGTAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010581.3-283s1c1
Sequence:CCGGCACCGAAGAAATGTTTGTGAACTCGAGTTCACAAACATTTCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010581.3-865s1c1
Sequence:CCGGCAATGTGTTTATGACAGCTTTCTCGAGAAAGCTGTCATAAACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010581.3-700s1c1
Sequence:CCGGCCATACGAATAAGAGAATCATCTCGAGATGATTCTCTTATTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-895s21c1
Sequence:CCGGCTCTTTCACCATTGCCATATTCTCGAGAATATGGCAATGGTGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-814s21c1
Sequence:CCGGTGGACTTGGCCTCATTGTAATCTCGAGATTACAATGAGGCCAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-567s21c1
Sequence:CCGGAGGAGAAAGGAGGTTGCAAATCTCGAGATTTGCAACCTCCTTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-389s21c1
Sequence:CCGGATCTCAGTCTCAGACTTAATCCTCGAGGATTAAGTCTGAGACTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-185s21c1
Sequence:CCGGGCTCAACTACTGTTTAGTAACCTCGAGGTTACTAAACAGTAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-307s21c1
Sequence:CCGGGAAGTTGAACAAATCGTATATCTCGAGATATACGATTTGTTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010581
VALIDATED
CD47 MISSION shRNA shRNA Plasmid DNA
CD47 molecule
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010581.3-1767s1c1
Sequence:CCGGCCCGTTCTGCTACTTTGATTTCTCGAGAAATCAAAGTAGCAGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010581.3-1031s1c1
Sequence:CCGGGCAGAACTACTTGGATTAGTTCTCGAGAACTAATCCAAGTAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010581.3-283s1c1
Sequence:CCGGCACCGAAGAAATGTTTGTGAACTCGAGTTCACAAACATTTCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010581.3-865s1c1
Sequence:CCGGCAATGTGTTTATGACAGCTTTCTCGAGAAAGCTGTCATAAACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010581.3-700s1c1
Sequence:CCGGCCATACGAATAAGAGAATCATCTCGAGATGATTCTCTTATTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-895s21c1
Sequence:CCGGCTCTTTCACCATTGCCATATTCTCGAGAATATGGCAATGGTGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-814s21c1
Sequence:CCGGTGGACTTGGCCTCATTGTAATCTCGAGATTACAATGAGGCCAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-567s21c1
Sequence:CCGGAGGAGAAAGGAGGTTGCAAATCTCGAGATTTGCAACCTCCTTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-389s21c1
Sequence:CCGGATCTCAGTCTCAGACTTAATCCTCGAGGATTAAGTCTGAGACTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-185s21c1
Sequence:CCGGGCTCAACTACTGTTTAGTAACCTCGAGGTTACTAAACAGTAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-307s21c1
Sequence:CCGGGAAGTTGAACAAATCGTATATCTCGAGATATACGATTTGTTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010581
VALIDATED
CD47 MISSION shRNA Lentiviral Transduction Particles
CD47 molecule
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010581.3-1767s1c1
Sequence:CCGGCCCGTTCTGCTACTTTGATTTCTCGAGAAATCAAAGTAGCAGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010581.3-1031s1c1
Sequence:CCGGGCAGAACTACTTGGATTAGTTCTCGAGAACTAATCCAAGTAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010581.3-283s1c1
Sequence:CCGGCACCGAAGAAATGTTTGTGAACTCGAGTTCACAAACATTTCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010581.3-865s1c1
Sequence:CCGGCAATGTGTTTATGACAGCTTTCTCGAGAAAGCTGTCATAAACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010581.3-700s1c1
Sequence:CCGGCCATACGAATAAGAGAATCATCTCGAGATGATTCTCTTATTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-895s21c1
Sequence:CCGGCTCTTTCACCATTGCCATATTCTCGAGAATATGGCAATGGTGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-814s21c1
Sequence:CCGGTGGACTTGGCCTCATTGTAATCTCGAGATTACAATGAGGCCAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-567s21c1
Sequence:CCGGAGGAGAAAGGAGGTTGCAAATCTCGAGATTTGCAACCTCCTTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-389s21c1
Sequence:CCGGATCTCAGTCTCAGACTTAATCCTCGAGGATTAAGTCTGAGACTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-185s21c1
Sequence:CCGGGCTCAACTACTGTTTAGTAACCTCGAGGTTACTAAACAGTAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010581.3-307s21c1
Sequence:CCGGGAAGTTGAACAAATCGTATATCTCGAGATATACGATTTGTTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks