EMAIL THIS PAGE TO A FRIEND

CD48

CD48 molecule

169 Gene Product Result for
Synonyms: BCM1 BLAST BLAST1 MEM-102 SLAMF2 hCD48 mCD48
UniProtKB ID: P09326, Q5U055
Gene ID:
Human(962) Summary: This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(12506) CD48 antigen
Rat(245962) Cd48 molecule
chicken(100859319) CD48 molecule
domestic cat(101089831) CD48 molecule
cow(508386) CD48 molecule
dog(488642) CD48 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105321 Anti-CD48 (156-170) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1405591 Anti-CD48 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA055146 Anti-CD48 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0000962M1 Monoclonal Anti-CD48 antibody produced in mouse clone 3B8-2C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB4700192 Monoclonal Anti-CD48 antibody produced in mouse clone MEM-102, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700193 Monoclonal Anti-CD48-APC antibody produced in mouse clone MEM-102, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700194 Monoclonal Anti-CD48-Biotin antibody produced in mouse clone MEM-102, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700195 Monoclonal Anti-CD48-FITC antibody produced in mouse clone MEM-102, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700196 Monoclonal Anti-CD48-PE antibody produced in mouse clone MEM-102, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001778 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016051 MISSION® esiRNA esiRNA targeting human CD48 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001778 Rosetta Predictions human pricing
NM_139103 Rosetta Predictions rat pricing
NM_007649 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228652 predicted 599
2 SASI_Hs01_00228654 predicted 571
3 SASI_Hs01_00228655 predicted 735
4 SASI_Hs01_00228656 predicted 694
5 SASI_Hs01_00228657 predicted 280
6 SASI_Hs01_00228658 predicted 247
7 SASI_Hs01_00228659 predicted 396
8 SASI_Hs01_00228660 predicted 343
9 SASI_Hs01_00228661 predicted 303
10 SASI_Hs02_00332530 predicted 564
11 SASI_Hs01_00228653 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079060 predicted 392
2 SASI_Rn01_00079061 predicted 344
3 SASI_Rn01_00079062 predicted 554
4 SASI_Rn01_00079063 predicted 752
5 SASI_Rn01_00079064 predicted 847
6 SASI_Rn01_00079065 predicted 578
7 SASI_Rn01_00079066 predicted 224
8 SASI_Rn01_00079067 predicted 291
9 SASI_Rn01_00079068 predicted 305
10 SASI_Rn02_00268478 predicted 649
11 SASI_Rn01_00079069 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312134 predicted 558
2 SASI_Mm01_00115131 predicted 267
3 SASI_Mm01_00115132 predicted 848
4 SASI_Mm01_00115133 predicted 647
5 SASI_Mm01_00115134 predicted 427
6 SASI_Mm01_00115135 predicted 556
7 SASI_Mm01_00115136 predicted 448
8 SASI_Mm01_00115137 predicted 631
9 SASI_Mm01_00115138 predicted 505
10 SASI_Mm01_00115139 predicted 728
11 SASI_Mm01_00115130 predicted 590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001778
VALIDATED
CD48 MISSION shRNA Bacterial Glycerol Stock
CD48 molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001778.2-306s21c1
Sequence:CCGGGGCGCACTGTACATCTCTAAGCTCGAGCTTAGAGATGTACAGTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001778.2-252s21c1
Sequence:CCGGTCTAAGTACTTTGAATCCAAACTCGAGTTTGGATTCAAAGTACTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001778.2-873s21c1
Sequence:CCGGGCTGAATTATCAACGAGGATTCTCGAGAATCCTCGTTGATAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001778.2-180s1c1
Sequence:CCGGCCTGAGAACTACAAACAACTACTCGAGTAGTTGTTTGTAGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_001778.2-685s1c1
Sequence:CCGGCCCGGTCCTTTGGAGTAGAATCTCGAGATTCTACTCCAAAGGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_001778.2-505s1c1
Sequence:CCGGGCGAGTCTGTAAACTACACCTCTCGAGAGGTGTAGTTTACAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_001778.2-735s1c1
Sequence:CCGGCCCACCATTCTTGGCCTGTTACTCGAGTAACAGGCCAAGAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001778.2-568s1c1
Sequence:CCGGGTGTGCTTGAAACCACCCTTACTCGAGTAAGGGTGGTTTCAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001778
VALIDATED
CD48 MISSION shRNA shRNA Plasmid DNA
CD48 molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001778.2-306s21c1
Sequence:CCGGGGCGCACTGTACATCTCTAAGCTCGAGCTTAGAGATGTACAGTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001778.2-252s21c1
Sequence:CCGGTCTAAGTACTTTGAATCCAAACTCGAGTTTGGATTCAAAGTACTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001778.2-873s21c1
Sequence:CCGGGCTGAATTATCAACGAGGATTCTCGAGAATCCTCGTTGATAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001778.2-180s1c1
Sequence:CCGGCCTGAGAACTACAAACAACTACTCGAGTAGTTGTTTGTAGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_001778.2-685s1c1
Sequence:CCGGCCCGGTCCTTTGGAGTAGAATCTCGAGATTCTACTCCAAAGGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_001778.2-505s1c1
Sequence:CCGGGCGAGTCTGTAAACTACACCTCTCGAGAGGTGTAGTTTACAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_001778.2-735s1c1
Sequence:CCGGCCCACCATTCTTGGCCTGTTACTCGAGTAACAGGCCAAGAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001778.2-568s1c1
Sequence:CCGGGTGTGCTTGAAACCACCCTTACTCGAGTAAGGGTGGTTTCAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001778
VALIDATED
CD48 MISSION shRNA Lentiviral Transduction Particles
CD48 molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001778.2-306s21c1
Sequence:CCGGGGCGCACTGTACATCTCTAAGCTCGAGCTTAGAGATGTACAGTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001778.2-252s21c1
Sequence:CCGGTCTAAGTACTTTGAATCCAAACTCGAGTTTGGATTCAAAGTACTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001778.2-873s21c1
Sequence:CCGGGCTGAATTATCAACGAGGATTCTCGAGAATCCTCGTTGATAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001778.2-180s1c1
Sequence:CCGGCCTGAGAACTACAAACAACTACTCGAGTAGTTGTTTGTAGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_001778.2-685s1c1
Sequence:CCGGCCCGGTCCTTTGGAGTAGAATCTCGAGATTCTACTCCAAAGGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_001778.2-505s1c1
Sequence:CCGGGCGAGTCTGTAAACTACACCTCTCGAGAGGTGTAGTTTACAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_001778.2-735s1c1
Sequence:CCGGCCCACCATTCTTGGCCTGTTACTCGAGTAACAGGCCAAGAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001778.2-568s1c1
Sequence:CCGGGTGTGCTTGAAACCACCCTTACTCGAGTAAGGGTGGTTTCAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007649
CD48 MISSION shRNA Bacterial Glycerol Stock
CD48 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-285s1c1
Sequence:CCGGGCAGGGTTTATCTTGAAGAAACTCGAGTTTCTTCAAGATAAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-693s1c1
Sequence:CCGGCTGGAGTATGTTGGACTGCAACTCGAGTTGCAGTCCAACATACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-590s1c1
Sequence:CCGGCCACAGAACAAGTCTACATTTCTCGAGAAATGTAGACTTGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-430s1c1
Sequence:CCGGGCCTTCCATAGAAATCAATAACTCGAGTTATTGATTTCTATGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-112s1c1
Sequence:CCGGAGGTCATTCAATACCAGATATCTCGAGATATCTGGTATTGAATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007649
CD48 MISSION shRNA shRNA Plasmid DNA
CD48 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-285s1c1
Sequence:CCGGGCAGGGTTTATCTTGAAGAAACTCGAGTTTCTTCAAGATAAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-693s1c1
Sequence:CCGGCTGGAGTATGTTGGACTGCAACTCGAGTTGCAGTCCAACATACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-590s1c1
Sequence:CCGGCCACAGAACAAGTCTACATTTCTCGAGAAATGTAGACTTGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-430s1c1
Sequence:CCGGGCCTTCCATAGAAATCAATAACTCGAGTTATTGATTTCTATGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-112s1c1
Sequence:CCGGAGGTCATTCAATACCAGATATCTCGAGATATCTGGTATTGAATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007649
CD48 MISSION shRNA Lentiviral Transduction Particles
CD48 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-285s1c1
Sequence:CCGGGCAGGGTTTATCTTGAAGAAACTCGAGTTTCTTCAAGATAAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-693s1c1
Sequence:CCGGCTGGAGTATGTTGGACTGCAACTCGAGTTGCAGTCCAACATACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-590s1c1
Sequence:CCGGCCACAGAACAAGTCTACATTTCTCGAGAAATGTAGACTTGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-430s1c1
Sequence:CCGGGCCTTCCATAGAAATCAATAACTCGAGTTATTGATTTCTATGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007649.2-112s1c1
Sequence:CCGGAGGTCATTCAATACCAGATATCTCGAGATATCTGGTATTGAATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks