EMAIL THIS PAGE TO A FRIEND

CD4

CD4 molecule

Synonyms: CD4mut
UniProtKB ID: P01730, B2R737, D3DUS5, Q4ZGK2, Q5U066, Q9UDE5
Gene ID:
Human(920) Summary: This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010]
Mouse(12504) CD4 antigen
Rat(24932) Cd4 molecule
Zebrafish(799982) CD4 molecule
chicken(395362) CD4 molecule
dog(403931) CD4 molecule
cow(407098) CD4 molecule
domestic cat(493775) CD4 molecule
sheep(443509) CD4 molecule
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA004252 Anti-CD4 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA004472 Anti-CD4 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB5500064 Anti-CD4 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP35, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB4503583 Anti-CD4, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB4504134 Anti-phospho-CD4 (pSer433) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB4700059 Monoclonal Anti-CD4 , (N-terminal) antibody produced in mouse clone MEM-241, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
C1805 Monoclonal Anti-CD4 antibody produced in mouse clone Q4120, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700054 Monoclonal Anti-CD4 antibody produced in mouse clone MEM-16, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700065 Monoclonal Anti-CD4 antibody produced in mouse clone MEM-115, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700733 Monoclonal Anti-CD4 antibody produced in mouse clone OX-35, purified immunoglobulin, buffered aqueous solution rat
flow cytometry, immunocytochemistry, immunohistochemistry pricing
SAB4100489 Monoclonal Anti-CD4 antibody produced in mouse clone CD4 -A409, culture supernatant human
western blot pricing
AMAB90754 Monoclonal Anti-CD4 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0395, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4700064 Monoclonal Anti-CD4 azide free antibody produced in mouse clone MEM-115, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700556 Monoclonal Anti-Cd4 azide free antibody produced in rat clone GK1.5, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700060 Monoclonal Anti-CD4-APC , (N-terminal) antibody produced in mouse clone MEM-241, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700557 Monoclonal Anti-Cd4-APC antibody produced in rat clone GK1.5, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700061 Monoclonal Anti-CD4-Biotin , (N-terminal) antibody produced in mouse clone MEM-241, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700062 Monoclonal Anti-CD4-FITC , (N-terminal) antibody produced in mouse clone MEM-241, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
F1773 Monoclonal Anti-CD4−FITC antibody produced in mouse clone Q4120, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700063 Monoclonal Anti-CD4-PE , (N-terminal) antibody produced in mouse clone MEM-241, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
P7562 Monoclonal Anti-CD4−PE antibody produced in mouse clone Q4120, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700558 Monoclonal Anti-Cd4-PE antibody produced in rat clone GK1.5, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
R8886 Monoclonal Anti-CD4−Quantum Red antibody produced in mouse clone Q4120, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

ELISA

Product # Description Species Add to Cart
 
RAB1339 Human CD4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000616 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033641 MISSION® esiRNA esiRNA human CD4 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
CBL1506 Anti-CD4 Antibody, clone OX-38 500 µg, This Anti-CD4 Antibody, clone OX-38 is validated for use in FC, IH for the detection of CD4. pricing
MABF416 Anti-CD4 Antibody (human), APC, clone OKT4 100 tests, This Mouse Monoclonal Antibody Anti-CD4 (human), APC, clone OKT4, Cat. No. MABF416 is validated for use in WB, IP, IC, IF, FC for the detection of CD4. pricing
MABF572 Anti-CD4 Antibody (human), APC, clone OKT4 25 tests, This mouse monoclonal antibody Anti-CD4 (human), APC & clone OKT4 validated for use in western blotting, IP, ICC, Immunofluorescence and Flow Cytometry for the detection of CD4. pricing
MABF422 Anti-CD4 Antibody (human), APC-Cy7, clone RPA-T4 100 tests, This mouse monoclonal antibody Anti-CD4 (human), APC-Cy7, clone RPA-T4 validated for use in IP, IHC & Flow Cytometry for the detection of CD4. pricing
MABF579 Anti-CD4 Antibody (human), APC-Cy7, clone RPA-T4 25 tests, This mouse monoclonal antibody Anti-CD4 (human), APC-Cy7, clone RPA-T4 validated for use in IP, IHC & Flow Cytometry for the detection of CD4. pricing
MABF419 Anti-CD4 Antibody (human), clone OKT4 100 µg, This Mouse Monoclonal Antibody Anti-CD4 (human), clone OKT4, Cat. No. MABF419 is validated for use in WB, IP, Immunocytochemistry, Immunofluorescence, Flow Cytometry for the detection of CD4. pricing
MABF417 Anti-CD4 Antibody (human), PE, clone OKT4 100 tests, This Mouse Monoclonal Antibody Anti-CD4 (human), PE, clone OKT4, Cat. No. MABF417 is validated for use in WB, IF, FC for the detection of CD4. pricing
MABF573 Anti-CD4 Antibody (human), PE, clone OKT4 25 tests, This mouse monoclonal antibody Anti-CD4 (human), PE, clone OKT4 validated for use in western blotting, Immunofluorescence & Flow Cytometry for the detection of CD4. pricing
MABF421 Anti-CD4 Antibody (human), PE-Cy7, clone RPA-T4 100 tests, This mouse monoclonal antibody Anti-CD4 (human), PE-Cy7, clone RPA-T4 validated for use in IP, IHC & Flow Cytometry for the detection of CD4. pricing
MABF578 Anti-CD4 Antibody (human), PE-Cy7, clone RPA-T4 25 tests, This mouse monoclonal antibody Anti-CD4 (human), PE-Cy7, clone RPA-T4 validated for use in IP, IHC & Flow Cytometry for the detection of CD4. This CD4 mouse antibody has been tested in Mouse samples. pricing
MABF418 Anti-CD4 Antibody (human), PerCP-Cy5.5, clone OKT4 100 tests, This mouse monoclonal antibody Anti-CD4 (human), PerCP-Cy5.5, clone OKT4 validated for use in western blotting, IP, ICC, Immunofluorescence & Flow Cytometry for the detection of CD4. pricing
MABF574 Anti-CD4 Antibody (human), PerCP-Cy5.5, clone OKT4 25 tests, This mouse monoclonal antibody Anti-CD4 (human), PerCP-Cy5.5, clone OKT4 validated for use in western blotting, IP, ICC, Immunofluorescence & Flow Cytometry for the detection of CD4. pricing
MAB3706 Anti-CD4 Antibody, intracellular, clone 024-10D6.B3 100 µg, Detect CD4 using this Anti-CD4 Antibody, intracellular, clone 024-10D6.B3 validated for use in ELISA, EMSA, FUNC & IC. pricing
MABF420 Anti-CD4 Antibody (mouse), APC-Cy7, clone RM4-5 100 µg, This rat monoclonal antibody Anti-CD4 (mouse), APC-Cy7, clone RM4-5 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD4. pricing
MABF577 Anti-CD4 Antibody (mouse), APC-Cy7, clone RM4-5 25 µg, This rat monoclonal antibody Anti-CD4 (mouse), APC-Cy7, clone RM4-5 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD4. pricing
MABF415 Anti-CD4 Antibody (mouse), clone GK1.5 100 µg, This Rat Monoclonal Antibody Anti-CD4 (mouse), clone GK1.5, Cat. No. MABF415 is validated for use in Immunoprecipitation, Immunohistochemistry, Flow Cytometry for the detection of CD4. pricing
MABF569 Anti-CD4 Antibody (mouse), FITC, clone GK1.5 25 µg, This rat monoclonal antibody Anti-CD4 (mouse), FITC, clone GK1.5 validated for use in IP, IHC & Flow Cytometry for the detection of CD4. pricing
MABF571 Anti-CD4 Antibody (mouse), Pe-Cy7, clone GK1.5 25 µg, This rat monoclonal antibody Anti-CD4 (mouse), Pe-Cy7, clone GK1.5 validated for use in IP, IHC & Flow Cytometry for the detection of CD4. pricing
MABF414 Anti-CD4 Antibody (mouse), PE-Cy7, clone GK1.5 100 µg, This rat monoclonal antibody Anti-CD4 (mouse), PE-Cy7, clone GK1.5 validated for use in IP, IHC & Flow Cytometry for the detection of CD4. pricing
MABF567 Anti-CD4 Antibody (mouse), violetFluor™ 450, clone GK1.5 25 µg, This rat monoclonal antibody Anti-CD4 (mouse), violetFluor 450, clone GK1.5 validated for use in IP, IHC & Flow Cytometry for the detection of CD4. pricing
MABF568 Anti-CD4 Antibody (mouse), violetFluor™ 450, clone GK1.5 100 µg, This rat monoclonal antibody Anti-CD4 (mouse), violetFluor 450, clone GK1.5 validated for use in IP, IHC & Flow Cytometry for the detection of CD4. pricing
MABF575 Anti-CD4 Antibody (mouse), violetFluor™ 450, clone RM4-5 25 µg, This rat monoclonal antibody Anti-CD4 (mouse), violetFluor 450, clone RM4-5 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD4. pricing
MABF576 Anti-CD4 Antibody (mouse), violetFluor™ 450, clone RM4-5 100 µg, This rat monoclonal antibody Anti-CD4 (mouse), violetFluor 450, clone RM4-5 validated for use in IP, IHC, Immunofluorescence & Flow Cytometry for the detection of CD4. This CD4 antibody has been tested in Mouse samples. pricing
MABF750 Anti-CD4, clone EPR6855, Rabbit Monoclonal Antibody 100 µL, This Anti-CD4 antibody is validated for use in WB, IH, FC for the detection of CD4. pricing
MABF171E Anti-CD4 (human), PE, clone RPA-T4 Antibody 25 tests, This Anti-CD4 (human), PE, clone RPA-T4 Antibody is validated for use in Flow Cytometry for the detection of CD4. pricing
MABF172B Anti-CD4 (human), PerCP, clone SK3 Antibody 25 tests, Anti-CD4 (human), PerCP, clone SK3 Antibody is an antibody against CD4 for use in Flow Cytometry. pricing
MABF172C Anti-CD4 (human), violetFluor™ 450, clone RPA-T4 Antibody 25 tests, This mouse monoclonal Anti-CD4 Antibody (human), violetFluor™ 450, clone RPA-T4, Cat. No. MABF1727 is validated for use in Flow Cytometry, for the detection of CD4. pricing
MABF156C Anti-CD4 (Mouse), APC, clone RM4-5 Antibody 25 μg, This Anti-CD4 (Mouse), APC, clone RM4-5 Antibody is validated for use in Flow Cytometry for the detection of CD4. pricing
MABF156D Anti-CD4 (Mouse), FITC, clone RM4-5 Antibody 25 μg, This Anti-CD4 (Mouse), FITC, clone RM4-5 Antibody is validated for use in Flow Cytometry for the detection of CD4. pricing
MABF156E Anti-CD4 (Mouse), PE, clone RM4-5 Antibody 100 μg, Anti-CD4 (Mouse), PE, clone RM4-5 Antibody is an antibody against CD4 for use in Flow Cytometry. pricing
MABF157A Anti-CD4 (Mouse), PE-Cy7, clone RM4-5 Antibody 25 μg, This rat monoclonal Anti-CD4 Antibody (Mouse), PE-Cy7, clone RM4-5, Cat. No. MABF1572 is validated for use in Flow Cytometry, for the detection of CD4. pricing
MABF157B Anti-CD4 (Mouse), PerCP-Cy5.5, clone RM4-5 Antibody 25 μg, This rat monoclonal Anti-CD4 Antibody (Mouse), PerCP-Cy5.5, clone RM4-5, Cat. No. MABF1574 is validated for use in Flow Cytometry, for the detection of CD4. pricing
MABF157C Anti-CD4 (Mouse), redFluor™ 710 Antibody, clone RM4-5 25 μg, This rat monoclonal Anti-CD4 Antibody (Mouse), redFluor™ 710, clone GK1.5, Cat. No. MABF1575 is validated for use in Flow Cytometry, for the detection of CD4. pricing
MABF157D Anti-CD4 (Mouse), redFluor™ 710 Antibody, clone RM4-5 25 μg, This rat monoclonal Anti-CD4 Antibody (Mouse), redFluor™ 710, clone RM4-5, Cat. No. MABF1577 is validated for use in Flow Cytometry, for the detection of CD4. pricing
IHCR2110-6 IHC Select® Anti-CD4 Antibody, prediluted, clone 4B12 6 mL, This IHC Select Anti-CD4 Antibody, prediluted, clone 4B12 is validated for use in IH(P) for the detection of CD4. pricing
FCMAB244CP5 Milli-Mark® Anti-mouse CD4-PerCP/Cy5.5 Antibody, clone GK1.5 100 tests, Detect mouse CD4 using this Milli-Mark Anti-mouse CD4-PerCP/Cy5.5 Antibody, clone GK1.5 validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000616 Rosetta Predictions human pricing
NM_012705 Rosetta Predictions rat pricing
NM_013488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149095 predicted 615
2 SASI_Hs01_00149096 predicted 378
3 SASI_Hs01_00149097 predicted 1246
4 SASI_Hs01_00149098 predicted 431
5 SASI_Hs01_00149099 predicted 522
6 SASI_Hs01_00149100 predicted 1044
7 SASI_Hs02_00302942 predicted 1150
8 SASI_Hs01_00149101 predicted 319
9 SASI_Hs01_00149102 predicted 467
10 SASI_Hs01_00149103 predicted 540
11 SASI_Hs01_00149104 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084560 predicted 1192
2 SASI_Rn02_00260021 predicted 1175
3 SASI_Rn01_00084561 predicted 620
4 SASI_Rn01_00084563 predicted 1213
5 SASI_Rn01_00084565 predicted 859
6 SASI_Rn01_00084566 predicted 956
7 SASI_Rn01_00084567 predicted 682
8 SASI_Rn02_00260022 predicted 1017
9 SASI_Rn01_00084568 predicted 955
10 SASI_Rn01_00084569 predicted 978
11 SASI_Rn01_00084562 predicted 714
12 SASI_Rn01_00084564 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125749 predicted 847
2 SASI_Mm01_00125750 predicted 440
3 SASI_Mm01_00125751 predicted 829
4 SASI_Mm01_00125752 predicted 793
5 SASI_Mm01_00125754 predicted 948
6 SASI_Mm01_00125755 predicted 605
7 SASI_Mm01_00125756 predicted 311
8 SASI_Mm02_00322127 predicted 656
9 SASI_Mm01_00125757 predicted 1518
10 SASI_Mm01_00125758 predicted 1349
11 SASI_Mm01_00125753 predicted 1288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013488
CD4 MISSION shRNA Bacterial Glycerol Stock
CD4 molecule
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000068273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013488.1-434s1c1
Sequence:CCGGGCATGGGAGAAAGGATCGTTTCTCGAGAAACGATCCTTTCTCCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013488.1-799s1c1
Sequence:CCGGCACAGCTATCACGGCCTATAACTCGAGTTATAGGCCGTGATAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013488.1-851s1c1
Sequence:CCGGCCACTCAACTTTGCAGAGGAACTCGAGTTCCTCTGCAAAGTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013488.1-1514s1c1
Sequence:CCGGCGGATGCAGAAGAGCCATAATCTCGAGATTATGGCTCTTCTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013488
CD4 MISSION shRNA shRNA Plasmid DNA
CD4 molecule
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000068273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013488.1-434s1c1
Sequence:CCGGGCATGGGAGAAAGGATCGTTTCTCGAGAAACGATCCTTTCTCCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013488.1-799s1c1
Sequence:CCGGCACAGCTATCACGGCCTATAACTCGAGTTATAGGCCGTGATAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013488.1-851s1c1
Sequence:CCGGCCACTCAACTTTGCAGAGGAACTCGAGTTCCTCTGCAAAGTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013488.1-1514s1c1
Sequence:CCGGCGGATGCAGAAGAGCCATAATCTCGAGATTATGGCTCTTCTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013488
CD4 MISSION shRNA Lentiviral Transduction Particles
CD4 molecule
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000068273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013488.1-434s1c1
Sequence:CCGGGCATGGGAGAAAGGATCGTTTCTCGAGAAACGATCCTTTCTCCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013488.1-799s1c1
Sequence:CCGGCACAGCTATCACGGCCTATAACTCGAGTTATAGGCCGTGATAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013488.1-851s1c1
Sequence:CCGGCCACTCAACTTTGCAGAGGAACTCGAGTTCCTCTGCAAAGTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013488.1-1514s1c1
Sequence:CCGGCGGATGCAGAAGAGCCATAATCTCGAGATTATGGCTCTTCTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000616
CD4 MISSION shRNA Bacterial Glycerol Stock
CD4 molecule
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000057616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000616.2-431s1c1
Sequence:CCGGCCTGATCATCAAGAATCTTAACTCGAGTTAAGATTCTTGATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000616.2-323s1c1
Sequence:CCGGCCAGATAAAGATTCTGGGAAACTCGAGTTTCCCAGAATCTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000616.2-352s1c1
Sequence:CCGGCCTTCTTAACTAAAGGTCCATCTCGAGATGGACCTTTAGTTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000616.2-1439s1c1
Sequence:CCGGAGAGCGGATGTCTCAGATCAACTCGAGTTGATCTGAGACATCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000616
CD4 MISSION shRNA shRNA Plasmid DNA
CD4 molecule
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000057616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000616.2-431s1c1
Sequence:CCGGCCTGATCATCAAGAATCTTAACTCGAGTTAAGATTCTTGATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000616.2-323s1c1
Sequence:CCGGCCAGATAAAGATTCTGGGAAACTCGAGTTTCCCAGAATCTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000616.2-352s1c1
Sequence:CCGGCCTTCTTAACTAAAGGTCCATCTCGAGATGGACCTTTAGTTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000616.2-1439s1c1
Sequence:CCGGAGAGCGGATGTCTCAGATCAACTCGAGTTGATCTGAGACATCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000616
CD4 MISSION shRNA Lentiviral Transduction Particles
CD4 molecule
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000057616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000616.2-431s1c1
Sequence:CCGGCCTGATCATCAAGAATCTTAACTCGAGTTAAGATTCTTGATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000616.2-323s1c1
Sequence:CCGGCCAGATAAAGATTCTGGGAAACTCGAGTTTCCCAGAATCTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000616.2-352s1c1
Sequence:CCGGCCTTCTTAACTAAAGGTCCATCTCGAGATGGACCTTTAGTTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000616.2-1439s1c1
Sequence:CCGGAGAGCGGATGTCTCAGATCAACTCGAGTTGATCTGAGACATCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks