EMAIL THIS PAGE TO A FRIEND

CD52

CD52 molecule

47 Gene Product Result for
Synonyms: CDW52
UniProtKB ID: P31358, Q5T138, Q9BW46
Gene ID:
Mouse(23833) CD52 antigen
Rat(117054) CD52 molecule
dog(403918) CD52 molecule
domestic cat(101085645) CD52 molecule
cow(507141) CD52 molecule
sheep(101111611) CD52 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001803 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055681 MISSION® esiRNA esiRNA human CD52 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001803 Rosetta Predictions human pricing
NM_053983 Rosetta Predictions rat pricing
NM_013706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115445 predicted 254
2 SASI_Hs01_00115446 predicted 210
3 SASI_Hs01_00115448 predicted 211
4 SASI_Hs01_00115449 predicted 284
5 SASI_Hs01_00115450 predicted 245
6 SASI_Hs01_00115451 predicted 258
7 SASI_Hs01_00115452 predicted 210
8 SASI_Hs01_00115453 predicted 239
9 SASI_Hs01_00115454 predicted 272
10 SASI_Hs02_00332579 predicted 266
11 SASI_Hs01_00115447 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036873 predicted 224
2 SASI_Rn01_00036874 predicted 219
3 SASI_Rn01_00036875 predicted 269
4 SASI_Rn01_00036876 predicted 443
5 SASI_Rn02_00266979 predicted 102
6 SASI_Rn01_00036877 predicted 455
7 SASI_Rn01_00036878 predicted 428
8 SASI_Rn01_00036879 predicted 82
9 SASI_Rn01_00036880 predicted 461
10 SASI_Rn01_00036881 predicted 93
11 SASI_Rn01_00036882 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181864 predicted 266
2 SASI_Mm01_00181865 predicted 268
3 SASI_Mm01_00181866 predicted 239
4 SASI_Mm01_00181867 predicted 227
5 SASI_Mm01_00181868 predicted 276
6 SASI_Mm01_00181870 predicted 261
7 SASI_Mm01_00181869 predicted 280
8 SASI_Mm01_00181873 predicted 461
9 SASI_Mm02_00322609 predicted 358
10 SASI_Mm02_00322610 predicted 125
11 SASI_Mm01_00181871 predicted 455
12 SASI_Mm01_00181872 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013706
VALIDATED
CD52 MISSION shRNA Bacterial Glycerol Stock
CD52 molecule
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013706.1-270s1c1
Sequence:CCGGCAATACCTTAATGTGCCTCTTCTCGAGAAGAGGCACATTAAGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013706.1-106s1c1
Sequence:CCGGATCATTCTTCTGGTTGTGATTCTCGAGAATCACAACCAGAAGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013706.1-247s1c1
Sequence:CCGGGCCTGCAGTTTCCTCTTCTTTCTCGAGAAAGAAGAGGAAACTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013706.1-163s1c1
Sequence:CCGGGCCGCTTCTGGTACTAACAAACTCGAGTTTGTTAGTACCAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013706.1-115s1c1
Sequence:CCGGCTGGTTGTGATTCAGATACAACTCGAGTTGTATCTGAATCACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013706.2-117s21c1
Sequence:CCGGATCATTCTTCTGGTTGTGATTCTCGAGAATCACAACCAGAAGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013706.2-174s21c1
Sequence:CCGGGCCGCTTCTGGTACTAACAAACTCGAGTTTGTTAGTACCAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013706.2-258s21c1
Sequence:CCGGGCCTGCAGTTTCCTCTTCTTTCTCGAGAAAGAAGAGGAAACTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013706.2-281s21c1
Sequence:CCGGCAATACCTTAATGTGCCTCTTCTCGAGAAGAGGCACATTAAGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013706
VALIDATED
CD52 MISSION shRNA shRNA Plasmid DNA
CD52 molecule
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013706.1-270s1c1
Sequence:CCGGCAATACCTTAATGTGCCTCTTCTCGAGAAGAGGCACATTAAGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013706.1-106s1c1
Sequence:CCGGATCATTCTTCTGGTTGTGATTCTCGAGAATCACAACCAGAAGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013706.1-247s1c1
Sequence:CCGGGCCTGCAGTTTCCTCTTCTTTCTCGAGAAAGAAGAGGAAACTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013706.1-163s1c1
Sequence:CCGGGCCGCTTCTGGTACTAACAAACTCGAGTTTGTTAGTACCAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013706.1-115s1c1
Sequence:CCGGCTGGTTGTGATTCAGATACAACTCGAGTTGTATCTGAATCACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013706.2-117s21c1
Sequence:CCGGATCATTCTTCTGGTTGTGATTCTCGAGAATCACAACCAGAAGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013706.2-174s21c1
Sequence:CCGGGCCGCTTCTGGTACTAACAAACTCGAGTTTGTTAGTACCAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013706.2-258s21c1
Sequence:CCGGGCCTGCAGTTTCCTCTTCTTTCTCGAGAAAGAAGAGGAAACTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013706.2-281s21c1
Sequence:CCGGCAATACCTTAATGTGCCTCTTCTCGAGAAGAGGCACATTAAGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013706
VALIDATED
CD52 MISSION shRNA Lentiviral Transduction Particles
CD52 molecule
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013706.1-270s1c1
Sequence:CCGGCAATACCTTAATGTGCCTCTTCTCGAGAAGAGGCACATTAAGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013706.1-106s1c1
Sequence:CCGGATCATTCTTCTGGTTGTGATTCTCGAGAATCACAACCAGAAGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013706.1-247s1c1
Sequence:CCGGGCCTGCAGTTTCCTCTTCTTTCTCGAGAAAGAAGAGGAAACTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013706.1-163s1c1
Sequence:CCGGGCCGCTTCTGGTACTAACAAACTCGAGTTTGTTAGTACCAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013706.1-115s1c1
Sequence:CCGGCTGGTTGTGATTCAGATACAACTCGAGTTGTATCTGAATCACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013706.2-117s21c1
Sequence:CCGGATCATTCTTCTGGTTGTGATTCTCGAGAATCACAACCAGAAGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013706.2-174s21c1
Sequence:CCGGGCCGCTTCTGGTACTAACAAACTCGAGTTTGTTAGTACCAGAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013706.2-258s21c1
Sequence:CCGGGCCTGCAGTTTCCTCTTCTTTCTCGAGAAAGAAGAGGAAACTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013706.2-281s21c1
Sequence:CCGGCAATACCTTAATGTGCCTCTTCTCGAGAAGAGGCACATTAAGGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001803
CD52 MISSION shRNA Bacterial Glycerol Stock
CD52 molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-60s1c1
Sequence:CCGGCCTCCTGGTTATGGTACAGATCTCGAGATCTGTACCATAACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-177s1c1
Sequence:CCGGCAATGCCATAATCCACCTCTTCTCGAGAAGAGGTGGATTATGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-140s1c1
Sequence:CCGGGCAGCATGAGCGGAGGCATTTCTCGAGAAATGCCTCCGCTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-76s1c1
Sequence:CCGGCAGATACAAACTGGACTCTCACTCGAGTGAGAGTCCAGTTTGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-64s1c1
Sequence:CCGGCTGGTTATGGTACAGATACAACTCGAGTTGTATCTGTACCATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001803.2-262s21c1
Sequence:CCGGTCCACCTCTTCTGCTTCAGTTCTCGAGAACTGAAGCAGAAGAGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001803.2-329s21c1
Sequence:CCGGCCACCATCACTCGCAAGAGAACTCGAGTTCTCTTGCGAGTGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001803.2-214s21c1
Sequence:CCGGGCAACATAAGCGGAGGCATTTCTCGAGAAATGCCTCCGCTTATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001803
CD52 MISSION shRNA shRNA Plasmid DNA
CD52 molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-60s1c1
Sequence:CCGGCCTCCTGGTTATGGTACAGATCTCGAGATCTGTACCATAACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-177s1c1
Sequence:CCGGCAATGCCATAATCCACCTCTTCTCGAGAAGAGGTGGATTATGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-140s1c1
Sequence:CCGGGCAGCATGAGCGGAGGCATTTCTCGAGAAATGCCTCCGCTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-76s1c1
Sequence:CCGGCAGATACAAACTGGACTCTCACTCGAGTGAGAGTCCAGTTTGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-64s1c1
Sequence:CCGGCTGGTTATGGTACAGATACAACTCGAGTTGTATCTGTACCATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001803.2-262s21c1
Sequence:CCGGTCCACCTCTTCTGCTTCAGTTCTCGAGAACTGAAGCAGAAGAGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001803.2-329s21c1
Sequence:CCGGCCACCATCACTCGCAAGAGAACTCGAGTTCTCTTGCGAGTGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001803.2-214s21c1
Sequence:CCGGGCAACATAAGCGGAGGCATTTCTCGAGAAATGCCTCCGCTTATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001803
CD52 MISSION shRNA Lentiviral Transduction Particles
CD52 molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-60s1c1
Sequence:CCGGCCTCCTGGTTATGGTACAGATCTCGAGATCTGTACCATAACCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-177s1c1
Sequence:CCGGCAATGCCATAATCCACCTCTTCTCGAGAAGAGGTGGATTATGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-140s1c1
Sequence:CCGGGCAGCATGAGCGGAGGCATTTCTCGAGAAATGCCTCCGCTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-76s1c1
Sequence:CCGGCAGATACAAACTGGACTCTCACTCGAGTGAGAGTCCAGTTTGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001803.1-64s1c1
Sequence:CCGGCTGGTTATGGTACAGATACAACTCGAGTTGTATCTGTACCATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001803.2-262s21c1
Sequence:CCGGTCCACCTCTTCTGCTTCAGTTCTCGAGAACTGAAGCAGAAGAGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001803.2-329s21c1
Sequence:CCGGCCACCATCACTCGCAAGAGAACTCGAGTTCTCTTGCGAGTGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001803.2-214s21c1
Sequence:CCGGGCAACATAAGCGGAGGCATTTCTCGAGAAATGCCTCCGCTTATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks