EMAIL THIS PAGE TO A FRIEND

CD53

CD53 molecule

Synonyms: MOX44 TSPAN25
UniProtKB ID: P19397, B2R905, Q5U0D6
Gene ID:
Human(963) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. It contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation. Familial deficiency of this gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(12508) CD53 antigen
Rat(24251) Cd53 molecule
sheep(101112271) CD53 molecule
domestic cat(101084381) CD53 molecule
cow(505040) CD53 molecule
Horse(100058745) CD53 molecule
dog(610454) CD53 molecule
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007651 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007651 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007651 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000560 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000560 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000560 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048151 MISSION® esiRNA esiRNA human CD53 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000560 Rosetta Predictions human pricing
NM_001040033 Rosetta Predictions human pricing
NM_012523 Rosetta Predictions rat pricing
NM_007651 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194123 predicted 257
2 SASI_Hs01_00194124 predicted 597
3 SASI_Hs01_00194125 predicted 733
4 SASI_Hs02_00302805 predicted 987
5 SASI_Hs01_00194126 predicted 1051
6 SASI_Hs01_00194127 predicted 886
7 SASI_Hs01_00194128 predicted 845
8 SASI_Hs01_00194129 predicted 579
9 SASI_Hs01_00194130 predicted 1007
10 SASI_Hs01_00194131 predicted 678
11 SASI_Hs01_00194132 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108023 predicted 261
2 SASI_Hs01_00108024 predicted 602
3 SASI_Hs01_00108025 predicted 735
4 SASI_Hs02_00308767 predicted 990
5 SASI_Hs01_00108026 predicted 1060
6 SASI_Hs01_00108027 predicted 891
7 SASI_Hs01_00108028 predicted 856
8 SASI_Hs01_00108029 predicted 583
9 SASI_Hs01_00108030 predicted 1018
10 SASI_Hs01_00108031 predicted 683
11 SASI_Hs01_00108032 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087111 predicted 821
2 SASI_Rn01_00087112 predicted 597
3 SASI_Rn01_00087113 predicted 765
4 SASI_Rn01_00087114 predicted 683
5 SASI_Rn01_00087115 predicted 517
6 SASI_Rn01_00087116 predicted 386
7 SASI_Rn01_00087117 predicted 310
8 SASI_Rn02_00259597 predicted 832
9 SASI_Rn01_00087118 predicted 802
10 SASI_Rn01_00087119 predicted 656
11 SASI_Rn01_00087120 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063195 predicted 691
2 SASI_Mm01_00063196 predicted 874
3 SASI_Mm01_00063197 predicted 525
4 SASI_Mm01_00063198 predicted 697
5 SASI_Mm01_00063199 predicted 804
6 SASI_Mm02_00312136 predicted 558
7 SASI_Mm01_00063201 predicted 349
8 SASI_Mm01_00063202 predicted 793
9 SASI_Mm01_00063203 predicted 361
10 SASI_Mm01_00063204 predicted 377
11 SASI_Mm01_00063200 predicted 203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007651
VALIDATED
CD53 MISSION shRNA Bacterial Glycerol Stock
CD53 molecule
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007651.3-280s21c1
Sequence:GTACCGGTTTGGGCTTTGGCATCTATTTCTCGAGAAATAGATGCCAAAGCCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007651.3-1222s21c1
Sequence:GTACCGGCAGAGTACTAGCCTAGCAAATCTCGAGATTTGCTAGGCTAGTACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007651.3-367s21c1
Sequence:GTACCGGGGTCATTGTGGGATCCATTATCTCGAGATAATGGATCCCACAATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007651.3-553s21c1
Sequence:GTACCGGGAATGACAGCATCCAACATTACTCGAGTAATGTTGGATGCTGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007651.3-1072s21c1
Sequence:GTACCGGAGCAGTAACCATATCCCTTAACTCGAGTTAAGGGATATGGTTACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-606s1c1
Sequence:CCGGGCAGATGTTCAGGGTTGCTATCTCGAGATAGCAACCCTGAACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-325s1c1
Sequence:CCGGGCATGGGCTCAATCAAGGAAACTCGAGTTTCCTTGATTGAGCCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-723s1c1
Sequence:CCGGCTGACACTCAACTGCCAGATTCTCGAGAATCTGGCAGTTGAGTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-411s1c1
Sequence:CCGGGCCATCCTGCTCTTTGTGTATCTCGAGATACACAAAGAGCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-205s1c1
Sequence:CCGGGCATCTATTTCCTGGTCCAAACTCGAGTTTGGACCAGGAAATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007651
VALIDATED
CD53 MISSION shRNA shRNA Plasmid DNA
CD53 molecule
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007651.3-280s21c1
Sequence:GTACCGGTTTGGGCTTTGGCATCTATTTCTCGAGAAATAGATGCCAAAGCCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007651.3-1222s21c1
Sequence:GTACCGGCAGAGTACTAGCCTAGCAAATCTCGAGATTTGCTAGGCTAGTACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007651.3-367s21c1
Sequence:GTACCGGGGTCATTGTGGGATCCATTATCTCGAGATAATGGATCCCACAATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007651.3-553s21c1
Sequence:GTACCGGGAATGACAGCATCCAACATTACTCGAGTAATGTTGGATGCTGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007651.3-1072s21c1
Sequence:GTACCGGAGCAGTAACCATATCCCTTAACTCGAGTTAAGGGATATGGTTACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-606s1c1
Sequence:CCGGGCAGATGTTCAGGGTTGCTATCTCGAGATAGCAACCCTGAACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-325s1c1
Sequence:CCGGGCATGGGCTCAATCAAGGAAACTCGAGTTTCCTTGATTGAGCCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-723s1c1
Sequence:CCGGCTGACACTCAACTGCCAGATTCTCGAGAATCTGGCAGTTGAGTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-411s1c1
Sequence:CCGGGCCATCCTGCTCTTTGTGTATCTCGAGATACACAAAGAGCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-205s1c1
Sequence:CCGGGCATCTATTTCCTGGTCCAAACTCGAGTTTGGACCAGGAAATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007651
VALIDATED
CD53 MISSION shRNA Lentiviral Transduction Particles
CD53 molecule
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007651.3-280s21c1
Sequence:GTACCGGTTTGGGCTTTGGCATCTATTTCTCGAGAAATAGATGCCAAAGCCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007651.3-1222s21c1
Sequence:GTACCGGCAGAGTACTAGCCTAGCAAATCTCGAGATTTGCTAGGCTAGTACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007651.3-367s21c1
Sequence:GTACCGGGGTCATTGTGGGATCCATTATCTCGAGATAATGGATCCCACAATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007651.3-553s21c1
Sequence:GTACCGGGAATGACAGCATCCAACATTACTCGAGTAATGTTGGATGCTGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007651.3-1072s21c1
Sequence:GTACCGGAGCAGTAACCATATCCCTTAACTCGAGTTAAGGGATATGGTTACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-606s1c1
Sequence:CCGGGCAGATGTTCAGGGTTGCTATCTCGAGATAGCAACCCTGAACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-325s1c1
Sequence:CCGGGCATGGGCTCAATCAAGGAAACTCGAGTTTCCTTGATTGAGCCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-723s1c1
Sequence:CCGGCTGACACTCAACTGCCAGATTCTCGAGAATCTGGCAGTTGAGTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-411s1c1
Sequence:CCGGGCCATCCTGCTCTTTGTGTATCTCGAGATACACAAAGAGCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007651.2-205s1c1
Sequence:CCGGGCATCTATTTCCTGGTCCAAACTCGAGTTTGGACCAGGAAATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000560
CD53 MISSION shRNA Bacterial Glycerol Stock
CD53 molecule
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000560.3-692s21c1
Sequence:CCGGCTGTGGTTTCATTCCAATTTCCTCGAGGAAATTGGAATGAAACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000560.3-1155s21c1
Sequence:GTACCGGCATCTTCCCATTGTCGAATTACTCGAGTAATTCGACAATGGGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000560.3-590s21c1
Sequence:CCGGCTGCAGTGTTGTGGTATAAATCTCGAGATTTATACCACAACACTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000560.3-334s21c1
Sequence:CCGGTGTCATCGTGGGCTCTATTATCTCGAGATAATAGAGCCCACGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000560.3-534s21c1
Sequence:CCGGACCGTTACCACTCAGACAATACTCGAGTATTGTCTGAGTGGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-442s1c1
Sequence:CCGGGCTGAATGAGTATGTGGCTAACTCGAGTTAGCCACATACTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-327s1c1
Sequence:CCGGGCATGGGCTCTATCAAGGAAACTCGAGTTTCCTTGATAGAGCCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-655s1c1
Sequence:CCGGCAATTTCCTGTATATCGGAATCTCGAGATTCCGATATACAGGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-490s1c1
Sequence:CCGGCCACTCAGACAATAGCACCAACTCGAGTTGGTGCTATTGTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-202s1c1
Sequence:CCGGCTTTGGGATCTACCTGCTGATCTCGAGATCAGCAGGTAGATCCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000560
CD53 MISSION shRNA shRNA Plasmid DNA
CD53 molecule
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000560.3-692s21c1
Sequence:CCGGCTGTGGTTTCATTCCAATTTCCTCGAGGAAATTGGAATGAAACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000560.3-1155s21c1
Sequence:GTACCGGCATCTTCCCATTGTCGAATTACTCGAGTAATTCGACAATGGGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000560.3-590s21c1
Sequence:CCGGCTGCAGTGTTGTGGTATAAATCTCGAGATTTATACCACAACACTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000560.3-334s21c1
Sequence:CCGGTGTCATCGTGGGCTCTATTATCTCGAGATAATAGAGCCCACGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000560.3-534s21c1
Sequence:CCGGACCGTTACCACTCAGACAATACTCGAGTATTGTCTGAGTGGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-442s1c1
Sequence:CCGGGCTGAATGAGTATGTGGCTAACTCGAGTTAGCCACATACTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-327s1c1
Sequence:CCGGGCATGGGCTCTATCAAGGAAACTCGAGTTTCCTTGATAGAGCCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-655s1c1
Sequence:CCGGCAATTTCCTGTATATCGGAATCTCGAGATTCCGATATACAGGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-490s1c1
Sequence:CCGGCCACTCAGACAATAGCACCAACTCGAGTTGGTGCTATTGTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-202s1c1
Sequence:CCGGCTTTGGGATCTACCTGCTGATCTCGAGATCAGCAGGTAGATCCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000560
CD53 MISSION shRNA Lentiviral Transduction Particles
CD53 molecule
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000560.3-692s21c1
Sequence:CCGGCTGTGGTTTCATTCCAATTTCCTCGAGGAAATTGGAATGAAACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000560.3-1155s21c1
Sequence:GTACCGGCATCTTCCCATTGTCGAATTACTCGAGTAATTCGACAATGGGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000560.3-590s21c1
Sequence:CCGGCTGCAGTGTTGTGGTATAAATCTCGAGATTTATACCACAACACTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000560.3-334s21c1
Sequence:CCGGTGTCATCGTGGGCTCTATTATCTCGAGATAATAGAGCCCACGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000560.3-534s21c1
Sequence:CCGGACCGTTACCACTCAGACAATACTCGAGTATTGTCTGAGTGGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-442s1c1
Sequence:CCGGGCTGAATGAGTATGTGGCTAACTCGAGTTAGCCACATACTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-327s1c1
Sequence:CCGGGCATGGGCTCTATCAAGGAAACTCGAGTTTCCTTGATAGAGCCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-655s1c1
Sequence:CCGGCAATTTCCTGTATATCGGAATCTCGAGATTCCGATATACAGGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-490s1c1
Sequence:CCGGCCACTCAGACAATAGCACCAACTCGAGTTGGTGCTATTGTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000560.2-202s1c1
Sequence:CCGGCTTTGGGATCTACCTGCTGATCTCGAGATCAGCAGGTAGATCCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks