EMAIL THIS PAGE TO A FRIEND

CD58

CD58 molecule

34 Gene Product Result for
Synonyms: LFA-3 LFA3 ag3
UniProtKB ID: P19256, A8K7G5, Q5U053, Q6IB65, Q96KI9
Gene ID:
Human(965) Summary: This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a ligand of the T lymphocyte CD2 protein, and functions in adhesion and activation of T lymphocytes. The protein is localized to the plasma membrane. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
sheep(101106474) CD58 molecule
sheep(100286740) CD58 molecule
cow(782186) CD58 molecule
domestic cat(101085141) CD58 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1346 Human CD58 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001779 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149591 MISSION® esiRNA esiRNA human CD58 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001779 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198187 predicted 334
2 SASI_Hs02_00332531 predicted 281
3 SASI_Hs01_00198188 predicted 475
4 SASI_Hs01_00198189 predicted 424
5 SASI_Hs01_00198190 predicted 671
6 SASI_Hs02_00332532 predicted 706
7 SASI_Hs01_00198192 predicted 312
8 SASI_Hs01_00198193 predicted 739
9 SASI_Hs01_00198194 predicted 496
10 SASI_Hs01_00198195 predicted 559
11 SASI_Hs01_00198191 predicted 581
12 SASI_Hs01_00198196 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001779
VALIDATED
CD58 MISSION shRNA Bacterial Glycerol Stock
CD58 molecule
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-387s21c1
Sequence:CCGGGCCTCACTATCTACAACTTAACTCGAGTTAAGTTGTAGATAGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-622s21c1
Sequence:CCGGACGTAACTCAACCAGTATATACTCGAGTATATACTGGTTGAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-225s21c1
Sequence:CCGGGTGTTGTGTATGGGAATGTAACTCGAGTTACATTCCCATACACAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-890s21c1
Sequence:CCGGGAAGACAACAGCATAACTAAACTCGAGTTTAGTTATGCTGTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-682s21c1
Sequence:CCGGTACTCTTAGCAATCCATTATTCTCGAGAATAATGGATTGCTAAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001779.1-700s1c1
Sequence:CCGGGTGCTGTATATGAATGGTATTCTCGAGAATACCATTCATATACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001779.1-113s1c1
Sequence:CCGGGTGTTGTGTATGGGAATGTAACTCGAGTTACATTCCCATACACAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001779.1-403s1c1
Sequence:CCGGGCATTGACTAATGGAAGCATTCTCGAGAATGCTTCCATTAGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001779.1-275s1c1
Sequence:CCGGGCCTCACTATCTACAACTTAACTCGAGTTAAGTTGTAGATAGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001779.1-635s1c1
Sequence:CCGGGCGGTCATTCAAGACACAGATCTCGAGATCTGTGTCTTGAATGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001779
VALIDATED
CD58 MISSION shRNA shRNA Plasmid DNA
CD58 molecule
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-387s21c1
Sequence:CCGGGCCTCACTATCTACAACTTAACTCGAGTTAAGTTGTAGATAGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-622s21c1
Sequence:CCGGACGTAACTCAACCAGTATATACTCGAGTATATACTGGTTGAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-225s21c1
Sequence:CCGGGTGTTGTGTATGGGAATGTAACTCGAGTTACATTCCCATACACAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-890s21c1
Sequence:CCGGGAAGACAACAGCATAACTAAACTCGAGTTTAGTTATGCTGTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-682s21c1
Sequence:CCGGTACTCTTAGCAATCCATTATTCTCGAGAATAATGGATTGCTAAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001779.1-700s1c1
Sequence:CCGGGTGCTGTATATGAATGGTATTCTCGAGAATACCATTCATATACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001779.1-113s1c1
Sequence:CCGGGTGTTGTGTATGGGAATGTAACTCGAGTTACATTCCCATACACAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001779.1-403s1c1
Sequence:CCGGGCATTGACTAATGGAAGCATTCTCGAGAATGCTTCCATTAGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001779.1-275s1c1
Sequence:CCGGGCCTCACTATCTACAACTTAACTCGAGTTAAGTTGTAGATAGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001779.1-635s1c1
Sequence:CCGGGCGGTCATTCAAGACACAGATCTCGAGATCTGTGTCTTGAATGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001779
VALIDATED
CD58 MISSION shRNA Lentiviral Transduction Particles
CD58 molecule
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-387s21c1
Sequence:CCGGGCCTCACTATCTACAACTTAACTCGAGTTAAGTTGTAGATAGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-622s21c1
Sequence:CCGGACGTAACTCAACCAGTATATACTCGAGTATATACTGGTTGAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-225s21c1
Sequence:CCGGGTGTTGTGTATGGGAATGTAACTCGAGTTACATTCCCATACACAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-890s21c1
Sequence:CCGGGAAGACAACAGCATAACTAAACTCGAGTTTAGTTATGCTGTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001779.2-682s21c1
Sequence:CCGGTACTCTTAGCAATCCATTATTCTCGAGAATAATGGATTGCTAAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001779.1-700s1c1
Sequence:CCGGGTGCTGTATATGAATGGTATTCTCGAGAATACCATTCATATACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001779.1-113s1c1
Sequence:CCGGGTGTTGTGTATGGGAATGTAACTCGAGTTACATTCCCATACACAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001779.1-403s1c1
Sequence:CCGGGCATTGACTAATGGAAGCATTCTCGAGAATGCTTCCATTAGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001779.1-275s1c1
Sequence:CCGGGCCTCACTATCTACAACTTAACTCGAGTTAAGTTGTAGATAGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001779.1-635s1c1
Sequence:CCGGGCGGTCATTCAAGACACAGATCTCGAGATCTGTGTCTTGAATGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks