EMAIL THIS PAGE TO A FRIEND

CD59

CD59 molecule, complement regulatory protein

275 Gene Product Result for
Synonyms: 16.3A5 1F5 EJ16 EJ30 EL32 G344 HRF-20 HRF20 MAC-IP MACIF MEM43 MIC11 MIN1 MIN2 MIN3 MIRL MSK21 p18-20
UniProtKB ID: P13987
Gene ID:
Human(966) Summary: This gene encodes a cell surface glycoprotein that regulates complement-mediated cell lysis, and it is involved in lymphocyte signal transduction. This protein is a potent inhibitor of the complement membrane attack complex, whereby it binds complement C8 and/or C9 during the assembly of this complex, thereby inhibiting the incorporation of multiple copies of C9 into the complex, which is necessary for osmolytic pore formation. This protein also plays a role in signal transduction pathways in the activation of T cells. Mutations in this gene cause CD59 deficiency, a disease resulting in hemolytic anemia and thrombosis, and which causes cerebral infarction. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
Rat(25407) CD59 molecule, complement regulatory protein
Zebrafish(335928) CD59 molecule, complement regulatory protein
chicken(423148) CD59 molecule, complement regulatory protein
cow(505574) CD59 molecule, complement regulatory protein
domestic cat(101092210) CD59 molecule, complement regulatory protein
dog(475945) CD59 molecule, complement regulatory protein
sheep(101102670) CD59 molecule, complement regulatory protein
Domestic Rabbit(100009459) CD59 molecule, complement regulatory protein
naked mole-rat(101726814) CD59 molecule, complement regulatory protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA026494 Anti-CD59 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1401061 Anti-CD59 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4700207 Monoclonal Anti-CD59 antibody produced in mouse clone MEM-43, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700214 Monoclonal Anti-CD59 antibody produced in mouse clone MEM-43/5, purified immunoglobulin, buffered aqueous solution mouse, human
flow cytometry pricing
SAB4700212 Monoclonal Anti-CD59 azide free antibody produced in mouse clone MEM-129, purified immunoglobulin, buffered aqueous solution human, pig
flow cytometry pricing
SAB4700208 Monoclonal Anti-CD59-APC antibody produced in mouse clone MEM-43, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700209 Monoclonal Anti-CD59-Biotin antibody produced in mouse clone MEM-43, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700210 Monoclonal Anti-CD59-FITC antibody produced in mouse clone MEM-43, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700211 Monoclonal Anti-CD59-PE antibody produced in mouse clone MEM-43, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000611 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094141 MISSION® esiRNA esiRNA human CD59 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000611 Rosetta Predictions human pricing
NM_001127223 Rosetta Predictions human pricing
NM_001127225 Rosetta Predictions human pricing
NM_001127226 Rosetta Predictions human pricing
NM_001127227 Rosetta Predictions human pricing
NM_203329 Rosetta Predictions human pricing
NM_203330 Rosetta Predictions human pricing
NM_203331 Rosetta Predictions human pricing
NM_012925 Rosetta Predictions rat pricing
XM_579359 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211452 predicted 898
2 SASI_Hs01_00211453 predicted 835
3 SASI_Hs01_00211454 predicted 838
4 SASI_Hs01_00211455 predicted 710
5 SASI_Hs02_00302919 predicted 305
6 SASI_Hs01_00211456 predicted 951
7 SASI_Hs01_00211457 predicted 690
8 SASI_Hs02_00302920 predicted 622
9 SASI_Hs01_00211459 predicted 977
10 SASI_Hs01_00211461 predicted 697
11 SASI_Hs01_00211458 predicted 852
12 SASI_Hs01_00211460 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328887 predicted 1065
2 SASI_Hs02_00328888 predicted 999
3 SASI_Hs02_00328889 predicted 996
4 SASI_Hs02_00328890 predicted 881
5 SASI_Hs02_00328891 predicted 466
6 SASI_Hs02_00328892 predicted 1123
7 SASI_Hs02_00328893 predicted 858
8 SASI_Hs02_00328894 predicted 780
9 SASI_Hs02_00328895 predicted 1147
10 SASI_Hs02_00328896 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328897 predicted 964
2 SASI_Hs02_00328898 predicted 886
3 SASI_Hs02_00328899 predicted 892
4 SASI_Hs02_00328900 predicted 772
5 SASI_Hs02_00328901 predicted 368
6 SASI_Hs02_00328902 predicted 1016
7 SASI_Hs02_00328903 predicted 754
8 SASI_Hs02_00328904 predicted 676
9 SASI_Hs02_00328905 predicted 1037
10 SASI_Hs02_00328906 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328907 predicted 900
2 SASI_Hs02_00328908 predicted 822
3 SASI_Hs02_00328909 predicted 832
4 SASI_Hs02_00328910 predicted 703
5 SASI_Hs02_00328911 predicted 302
6 SASI_Hs02_00328912 predicted 946
7 SASI_Hs02_00328913 predicted 681
8 SASI_Hs02_00328914 predicted 616
9 SASI_Hs02_00328915 predicted 975
10 SASI_Hs02_00328916 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328917 predicted 842
2 SASI_Hs02_00328918 predicted 765
3 SASI_Hs02_00328919 predicted 772
4 SASI_Hs02_00328920 predicted 654
5 SASI_Hs02_00328921 predicted 241
6 SASI_Hs02_00328922 predicted 891
7 SASI_Hs02_00328923 predicted 625
8 SASI_Hs02_00328924 predicted 553
9 SASI_Hs02_00328925 predicted 914
10 SASI_Hs02_00328926 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102887 predicted 1018
2 SASI_Hs01_00102888 predicted 945
3 SASI_Hs01_00102889 predicted 947
4 SASI_Hs01_00102890 predicted 825
5 SASI_Hs02_00373264 predicted 424
6 SASI_Hs01_00102891 predicted 1075
7 SASI_Hs01_00102892 predicted 808
8 SASI_Hs02_00373265 predicted 732
9 SASI_Hs01_00102894 predicted 1099
10 SASI_Hs01_00102896 predicted 819
11 SASI_Hs01_00102893 predicted 903
12 SASI_Hs01_00102895 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048650 predicted 1065
2 SASI_Hs01_00048651 predicted 993
3 SASI_Hs01_00048652 predicted 997
4 SASI_Hs01_00048653 predicted 873
5 SASI_Hs02_00373266 predicted 463
6 SASI_Hs01_00048654 predicted 1117
7 SASI_Hs01_00048655 predicted 854
8 SASI_Hs02_00373267 predicted 783
9 SASI_Hs01_00048657 predicted 1139
10 SASI_Hs01_00048659 predicted 862
11 SASI_Hs01_00048656 predicted 1016
12 SASI_Hs01_00048658 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228184 predicted 946
2 SASI_Hs01_00228185 predicted 873
3 SASI_Hs01_00228186 predicted 877
4 SASI_Hs01_00228187 predicted 755
5 SASI_Hs02_00373268 predicted 353
6 SASI_Hs01_00228188 predicted 1000
7 SASI_Hs01_00228189 predicted 733
8 SASI_Hs02_00373269 predicted 660
9 SASI_Hs01_00228191 predicted 1022
10 SASI_Hs01_00228193 predicted 747
11 SASI_Hs01_00228190 predicted 894
12 SASI_Hs01_00228192 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260469 predicted 202
2 SASI_Rn01_00067951 predicted 740
3 SASI_Rn01_00067952 predicted 740
4 SASI_Rn01_00067953 predicted 743
5 SASI_Rn01_00067954 predicted 215
6 SASI_Rn01_00067956 predicted 729
7 SASI_Rn01_00067957 predicted 200
8 SASI_Rn01_00067958 predicted 224
9 SASI_Rn01_00067959 predicted 224
10 SASI_Rn01_00067960 predicted 259
11 SASI_Rn01_00067955 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179867 predicted 493
2 SASI_Rn01_00179868 predicted 494
3 SASI_Rn01_00179869 predicted 502
4 SASI_Rn01_00179870 predicted 489
5 SASI_Rn01_00179871 predicted 497
6 SASI_Rn01_00179872 predicted 501
7 SASI_Rn01_00179873 predicted 515
8 SASI_Rn01_00179874 predicted 319
9 SASI_Rn01_00179875 predicted 669
10 SASI_Rn01_00179876 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000611
VALIDATED
CD59 MISSION shRNA Bacterial Glycerol Stock
CD59 molecule, complement regulatory protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000611.4-237s1c1
Sequence:CCGGCCGTCAATTGTTCATCTGATTCTCGAGAATCAGATGAACAATTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000611.4-364s1c1
Sequence:CCGGGCTAACGTACTACTGCTGCAACTCGAGTTGCAGCAGTAGTACGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000611.4-198s1c1
Sequence:CCGGGCTACAACTGTCCTAACCCAACTCGAGTTGGGTTAGGACAGTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000611.4-389s1c1
Sequence:CCGGGACCTGTGTAACTTTAACGAACTCGAGTTCGTTAAAGTTACACAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000611.4-260s1c1
Sequence:CCGGGATGCGTGTCTCATTACCAAACTCGAGTTTGGTAATGAGACACGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000611.5-261s21c1
Sequence:CCGGGATGCGTGTCTCATTACCAAACTCGAGTTTGGTAATGAGACACGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000611.5-238s21c1
Sequence:CCGGCCGTCAATTGTTCATCTGATTCTCGAGAATCAGATGAACAATTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_000611.5-390s21c1
Sequence:CCGGGACCTGTGTAACTTTAACGAACTCGAGTTCGTTAAAGTTACACAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000611.5-365s21c1
Sequence:CCGGGCTAACGTACTACTGCTGCAACTCGAGTTGCAGCAGTAGTACGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000611
VALIDATED
CD59 MISSION shRNA shRNA Plasmid DNA
CD59 molecule, complement regulatory protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000611.4-237s1c1
Sequence:CCGGCCGTCAATTGTTCATCTGATTCTCGAGAATCAGATGAACAATTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000611.4-364s1c1
Sequence:CCGGGCTAACGTACTACTGCTGCAACTCGAGTTGCAGCAGTAGTACGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000611.4-198s1c1
Sequence:CCGGGCTACAACTGTCCTAACCCAACTCGAGTTGGGTTAGGACAGTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000611.4-389s1c1
Sequence:CCGGGACCTGTGTAACTTTAACGAACTCGAGTTCGTTAAAGTTACACAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000611.4-260s1c1
Sequence:CCGGGATGCGTGTCTCATTACCAAACTCGAGTTTGGTAATGAGACACGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000611.5-261s21c1
Sequence:CCGGGATGCGTGTCTCATTACCAAACTCGAGTTTGGTAATGAGACACGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000611.5-238s21c1
Sequence:CCGGCCGTCAATTGTTCATCTGATTCTCGAGAATCAGATGAACAATTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_000611.5-390s21c1
Sequence:CCGGGACCTGTGTAACTTTAACGAACTCGAGTTCGTTAAAGTTACACAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000611.5-365s21c1
Sequence:CCGGGCTAACGTACTACTGCTGCAACTCGAGTTGCAGCAGTAGTACGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000611
VALIDATED
CD59 MISSION shRNA Lentiviral Transduction Particles
CD59 molecule, complement regulatory protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000611.4-237s1c1
Sequence:CCGGCCGTCAATTGTTCATCTGATTCTCGAGAATCAGATGAACAATTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000611.4-364s1c1
Sequence:CCGGGCTAACGTACTACTGCTGCAACTCGAGTTGCAGCAGTAGTACGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000611.4-198s1c1
Sequence:CCGGGCTACAACTGTCCTAACCCAACTCGAGTTGGGTTAGGACAGTTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000611.4-389s1c1
Sequence:CCGGGACCTGTGTAACTTTAACGAACTCGAGTTCGTTAAAGTTACACAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000611.4-260s1c1
Sequence:CCGGGATGCGTGTCTCATTACCAAACTCGAGTTTGGTAATGAGACACGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000611.5-261s21c1
Sequence:CCGGGATGCGTGTCTCATTACCAAACTCGAGTTTGGTAATGAGACACGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000611.5-238s21c1
Sequence:CCGGCCGTCAATTGTTCATCTGATTCTCGAGAATCAGATGAACAATTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_000611.5-390s21c1
Sequence:CCGGGACCTGTGTAACTTTAACGAACTCGAGTTCGTTAAAGTTACACAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000611.5-365s21c1
Sequence:CCGGGCTAACGTACTACTGCTGCAACTCGAGTTGCAGCAGTAGTACGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)