EMAIL THIS PAGE TO A FRIEND

CD5

CD5 molecule

75 Gene Product Result for
Synonyms: LEU1 T1
UniProtKB ID: P06127, A0N0P4, A8K9I3
Gene ID:
Mouse(12507) CD5 antigen
Rat(54236) Cd5 molecule
sheep(443328) CD5 molecule
chicken(395757) CD5 molecule
cow(280745) CD5 molecule
dog(612338) CD5 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104201 Anti-CD5 (26-40) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1104202 Anti-CD5 (441-455) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA043416 Anti-CD5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA060839 Anti-CD5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB5500069 Anti-CD5 antibody, Rabbit monoclonal clone SP19, recombinant, expressed in proprietary host, tissue culture supernatant human (tested)
immunohistochemistry pricing
SAB2105133 Anti-CD5, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4503585 Anti-CD5, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4504137 Anti-phospho-CD5 (pTyr453) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4100025 Monoclonal Anti-CD5 antibody produced in mouse culture supernatant human
western blot pricing
SAB4700066 Monoclonal Anti-CD5 antibody produced in mouse clone CRIS1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700071 Monoclonal Anti-CD5 antibody produced in mouse clone MEM-32, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700730 Monoclonal Anti-CD5 antibody produced in mouse clone L17F12, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunocytochemistry, immunoprecipitation, western blot pricing
SAB4700067 Monoclonal Anti-CD5-APC antibody produced in mouse clone CRIS1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700069 Monoclonal Anti-CD5-FITC antibody produced in mouse clone CRIS1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700070 Monoclonal Anti-CD5-PE antibody produced in mouse clone CRIS1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

ELISA

Product # Description Species Add to Cart
 
RAB1344 Human CD5 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039121 MISSION® esiRNA esiRNA human CD5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014207 Rosetta Predictions human pricing
NM_019295 Rosetta Predictions rat pricing
NM_007650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345226 predicted 262
2 SASI_Hs01_00193963 predicted 390
3 SASI_Hs01_00193964 predicted 461
4 SASI_Hs02_00345227 predicted 1650
5 SASI_Hs01_00193965 predicted 1915
6 SASI_Hs01_00193966 predicted 253
7 SASI_Hs01_00193967 predicted 1552
8 SASI_Hs01_00193969 predicted 1528
9 SASI_Hs01_00193970 predicted 510
10 SASI_Hs01_00193972 predicted 1066
11 SASI_Hs01_00193968 predicted 1629
12 SASI_Hs01_00193971 predicted 1277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100252 predicted 1154
2 SASI_Rn01_00100253 predicted 359
3 SASI_Rn01_00100254 predicted 1612
4 SASI_Rn01_00100255 predicted 1564
5 SASI_Rn01_00100256 predicted 1155
6 SASI_Rn01_00100257 predicted 1301
7 SASI_Rn01_00100258 predicted 295
8 SASI_Rn01_00100261 predicted 678
9 SASI_Rn02_00262253 predicted 369
10 SASI_Rn02_00262254 predicted 218
11 SASI_Rn01_00100259 predicted 1663
12 SASI_Rn01_00100260 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037732 predicted 1574
2 SASI_Mm01_00037733 predicted 858
3 SASI_Mm01_00037734 predicted 204
4 SASI_Mm01_00037735 predicted 1535
5 SASI_Mm01_00037736 predicted 1542
6 SASI_Mm01_00037737 predicted 1423
7 SASI_Mm01_00037738 predicted 442
8 SASI_Mm01_00037740 predicted 1643
9 SASI_Mm01_00037741 predicted 464
10 SASI_Mm02_00312135 predicted 1717
11 SASI_Mm01_00037739 predicted 1659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014207
CD5 MISSION shRNA Bacterial Glycerol Stock
CD5 molecule
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014207.2-2666s1c1
Sequence:CCGGCCACGCCATTTGATGCTGTATCTCGAGATACAGCATCAAATGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014207.2-1116s1c1
Sequence:CCGGCCACGAACTTTGGGAGAGAAACTCGAGTTTCTCTCCCAAAGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014207.2-1516s1c1
Sequence:CCGGGACAGTGACTATGATCTGCATCTCGAGATGCAGATCATAGTCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014207.2-1281s1c1
Sequence:CCGGAGTGAAGAAATTCCGCCAGAACTCGAGTTCTGGCGGAATTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014207.2-845s1c1
Sequence:CCGGGCCGAGTTCTTGCCCTCCTTTCTCGAGAAAGGAGGGCAAGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014207
CD5 MISSION shRNA shRNA Plasmid DNA
CD5 molecule
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014207.2-2666s1c1
Sequence:CCGGCCACGCCATTTGATGCTGTATCTCGAGATACAGCATCAAATGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014207.2-1116s1c1
Sequence:CCGGCCACGAACTTTGGGAGAGAAACTCGAGTTTCTCTCCCAAAGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014207.2-1516s1c1
Sequence:CCGGGACAGTGACTATGATCTGCATCTCGAGATGCAGATCATAGTCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014207.2-1281s1c1
Sequence:CCGGAGTGAAGAAATTCCGCCAGAACTCGAGTTCTGGCGGAATTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014207.2-845s1c1
Sequence:CCGGGCCGAGTTCTTGCCCTCCTTTCTCGAGAAAGGAGGGCAAGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014207
CD5 MISSION shRNA Lentiviral Transduction Particles
CD5 molecule
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014207.2-2666s1c1
Sequence:CCGGCCACGCCATTTGATGCTGTATCTCGAGATACAGCATCAAATGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014207.2-1116s1c1
Sequence:CCGGCCACGAACTTTGGGAGAGAAACTCGAGTTTCTCTCCCAAAGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014207.2-1516s1c1
Sequence:CCGGGACAGTGACTATGATCTGCATCTCGAGATGCAGATCATAGTCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014207.2-1281s1c1
Sequence:CCGGAGTGAAGAAATTCCGCCAGAACTCGAGTTCTGGCGGAATTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014207.2-845s1c1
Sequence:CCGGGCCGAGTTCTTGCCCTCCTTTCTCGAGAAAGGAGGGCAAGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007650
CD5 MISSION shRNA Bacterial Glycerol Stock
CD5 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007650.2-1631s1c1
Sequence:CCGGCTTGGACATTTGTCCTTTGTACTCGAGTACAAAGGACAAATGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007650.2-917s1c1
Sequence:CCGGCACCGTCATCTGCTCTGATTTCTCGAGAAATCAGAGCAGATGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007650.2-1544s1c1
Sequence:CCGGCCGATCTTCTACACAACCTGACTCGAGTCAGGTTGTGTAGAAGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007650.2-1461s1c1
Sequence:CCGGGCCTCTCATGTGGACAATGAACTCGAGTTCATTGTCCACATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007650.2-458s1c1
Sequence:CCGGGTGGTCTATATCCAACTGCAACTCGAGTTGCAGTTGGATATAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007650
CD5 MISSION shRNA shRNA Plasmid DNA
CD5 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007650.2-1631s1c1
Sequence:CCGGCTTGGACATTTGTCCTTTGTACTCGAGTACAAAGGACAAATGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007650.2-917s1c1
Sequence:CCGGCACCGTCATCTGCTCTGATTTCTCGAGAAATCAGAGCAGATGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007650.2-1544s1c1
Sequence:CCGGCCGATCTTCTACACAACCTGACTCGAGTCAGGTTGTGTAGAAGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007650.2-1461s1c1
Sequence:CCGGGCCTCTCATGTGGACAATGAACTCGAGTTCATTGTCCACATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007650.2-458s1c1
Sequence:CCGGGTGGTCTATATCCAACTGCAACTCGAGTTGCAGTTGGATATAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007650
CD5 MISSION shRNA Lentiviral Transduction Particles
CD5 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007650.2-1631s1c1
Sequence:CCGGCTTGGACATTTGTCCTTTGTACTCGAGTACAAAGGACAAATGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007650.2-917s1c1
Sequence:CCGGCACCGTCATCTGCTCTGATTTCTCGAGAAATCAGAGCAGATGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007650.2-1544s1c1
Sequence:CCGGCCGATCTTCTACACAACCTGACTCGAGTCAGGTTGTGTAGAAGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007650.2-1461s1c1
Sequence:CCGGGCCTCTCATGTGGACAATGAACTCGAGTTCATTGTCCACATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007650.2-458s1c1
Sequence:CCGGGTGGTCTATATCCAACTGCAACTCGAGTTGCAGTTGGATATAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks