EMAIL THIS PAGE TO A FRIEND

CD5L

CD5 molecule-like

94 Gene Product Result for
Synonyms: AIM API6 PRO229 SP-ALPHA Spalpha
UniProtKB ID: O43866, A8K7M5, Q6UX63
Gene ID:
Mouse(11801) CD5 antigen-like
Rat(310693) Cd5 molecule-like
naked mole-rat(101707771) CD5 molecule-like
domestic guinea pig(100729988) CD5 molecule-like
chicken(776284) CD5 molecule-like
cow(528593) CD5 molecule-like
domestic cat(101101287) CD5 molecule-like
dog(609953) CD5 molecule-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1347 Human CD5L ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005894 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136331 MISSION® esiRNA esiRNA human CD5L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005894 Rosetta Predictions human pricing
NM_001025685 Rosetta Predictions rat pricing
NM_009690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340494 predicted 1325
2 SASI_Hs02_00340495 predicted 1311
3 SASI_Hs01_00100252 predicted 1418
4 SASI_Hs01_00100253 predicted 404
5 SASI_Hs01_00100254 predicted 850
6 SASI_Hs01_00100255 predicted 338
7 SASI_Hs01_00100256 predicted 827
8 SASI_Hs01_00100257 predicted 710
9 SASI_Hs01_00100258 predicted 861
10 SASI_Hs01_00100259 predicted 1422
11 SASI_Hs01_00100251 predicted 1289
12 SASI_Hs01_00100260 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203290 predicted 455
2 SASI_Rn01_00043128 predicted 1378
3 SASI_Rn01_00043129 predicted 541
4 SASI_Rn01_00043130 predicted 1017
5 SASI_Rn01_00043131 predicted 1222
6 SASI_Rn01_00043132 predicted 549
7 SASI_Rn02_00203291 predicted 262
8 SASI_Rn01_00043133 predicted 1269
9 SASI_Rn01_00043134 predicted 1081
10 SASI_Rn01_00043135 predicted 1119
11 SASI_Rn01_00043127 predicted 380
12 SASI_Rn01_00043136 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070323 predicted 379
2 SASI_Mm01_00070324 predicted 761
3 SASI_Mm02_00316784 predicted 1465
4 SASI_Mm01_00070326 predicted 1256
5 SASI_Mm01_00070328 predicted 697
6 SASI_Mm02_00316785 predicted 435
7 SASI_Mm01_00070329 predicted 625
8 SASI_Mm01_00070330 predicted 1381
9 SASI_Mm01_00070331 predicted 1278
10 SASI_Mm02_00316786 predicted 440
11 SASI_Mm01_00070325 predicted 1368
12 SASI_Mm01_00070327 predicted 350
13 SASI_Mm01_00070332 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009690
CD5L MISSION shRNA Bacterial Glycerol Stock
CD5 molecule-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009690.1-1167s1c1
Sequence:CCGGGCCTCGAAAGAGTCTGAACATCTCGAGATGTTCAGACTCTTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009690.1-339s1c1
Sequence:CCGGGTTGGCTCAATGTGAGCTAAACTCGAGTTTAGCTCACATTGAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009690.1-286s1c1
Sequence:CCGGTCAGAGCAAAGAGTTCTTATTCTCGAGAATAAGAACTCTTTGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009690.1-283s1c1
Sequence:CCGGGCATCAGAGCAAAGAGTTCTTCTCGAGAAGAACTCTTTGCTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009690.1-533s1c1
Sequence:CCGGGCTGGAACTTACAGGTCTCAACTCGAGTTGAGACCTGTAAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009690
CD5L MISSION shRNA shRNA Plasmid DNA
CD5 molecule-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009690.1-1167s1c1
Sequence:CCGGGCCTCGAAAGAGTCTGAACATCTCGAGATGTTCAGACTCTTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009690.1-339s1c1
Sequence:CCGGGTTGGCTCAATGTGAGCTAAACTCGAGTTTAGCTCACATTGAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009690.1-286s1c1
Sequence:CCGGTCAGAGCAAAGAGTTCTTATTCTCGAGAATAAGAACTCTTTGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009690.1-283s1c1
Sequence:CCGGGCATCAGAGCAAAGAGTTCTTCTCGAGAAGAACTCTTTGCTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009690.1-533s1c1
Sequence:CCGGGCTGGAACTTACAGGTCTCAACTCGAGTTGAGACCTGTAAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009690
CD5L MISSION shRNA Lentiviral Transduction Particles
CD5 molecule-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009690.1-1167s1c1
Sequence:CCGGGCCTCGAAAGAGTCTGAACATCTCGAGATGTTCAGACTCTTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009690.1-339s1c1
Sequence:CCGGGTTGGCTCAATGTGAGCTAAACTCGAGTTTAGCTCACATTGAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009690.1-286s1c1
Sequence:CCGGTCAGAGCAAAGAGTTCTTATTCTCGAGAATAAGAACTCTTTGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009690.1-283s1c1
Sequence:CCGGGCATCAGAGCAAAGAGTTCTTCTCGAGAAGAACTCTTTGCTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009690.1-533s1c1
Sequence:CCGGGCTGGAACTTACAGGTCTCAACTCGAGTTGAGACCTGTAAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005894
CD5L MISSION shRNA Bacterial Glycerol Stock
CD5 molecule-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-379s1c1
Sequence:CCGGGAGCAAGAAGAAGTTTATGATCTCGAGATCATAAACTTCTTCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-938s1c1
Sequence:CCGGCCTCCTTCAGAGACCGGAAATCTCGAGATTTCCGGTCTCTGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-347s1c1
Sequence:CCGGGCACAGGAACAGAAGATACATCTCGAGATGTATCTTCTGTTCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-90s1c1
Sequence:CCGGCATTTGCACCAGACCTGGATTCTCGAGAATCCAGGTCTGGTGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-781s1c1
Sequence:CCGGCCCTTTGACTTGAGACTAGTACTCGAGTACTAGTCTCAAGTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005894.2-1253s21c1
Sequence:CCGGTGATTATCCTCATACTCATTCCTCGAGGAATGAGTATGAGGATAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005894.2-1558s21c1
Sequence:CCGGTACTAATCTAGGTCCTATTACCTCGAGGTAATAGGACCTAGATTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005894.2-1171s21c1
Sequence:CCGGTCATCTGCTCAGGATAGTATCCTCGAGGATACTATCCTGAGCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005894
CD5L MISSION shRNA shRNA Plasmid DNA
CD5 molecule-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-379s1c1
Sequence:CCGGGAGCAAGAAGAAGTTTATGATCTCGAGATCATAAACTTCTTCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-938s1c1
Sequence:CCGGCCTCCTTCAGAGACCGGAAATCTCGAGATTTCCGGTCTCTGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-347s1c1
Sequence:CCGGGCACAGGAACAGAAGATACATCTCGAGATGTATCTTCTGTTCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-90s1c1
Sequence:CCGGCATTTGCACCAGACCTGGATTCTCGAGAATCCAGGTCTGGTGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-781s1c1
Sequence:CCGGCCCTTTGACTTGAGACTAGTACTCGAGTACTAGTCTCAAGTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005894.2-1253s21c1
Sequence:CCGGTGATTATCCTCATACTCATTCCTCGAGGAATGAGTATGAGGATAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005894.2-1558s21c1
Sequence:CCGGTACTAATCTAGGTCCTATTACCTCGAGGTAATAGGACCTAGATTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005894.2-1171s21c1
Sequence:CCGGTCATCTGCTCAGGATAGTATCCTCGAGGATACTATCCTGAGCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005894
CD5L MISSION shRNA Lentiviral Transduction Particles
CD5 molecule-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-379s1c1
Sequence:CCGGGAGCAAGAAGAAGTTTATGATCTCGAGATCATAAACTTCTTCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-938s1c1
Sequence:CCGGCCTCCTTCAGAGACCGGAAATCTCGAGATTTCCGGTCTCTGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-347s1c1
Sequence:CCGGGCACAGGAACAGAAGATACATCTCGAGATGTATCTTCTGTTCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-90s1c1
Sequence:CCGGCATTTGCACCAGACCTGGATTCTCGAGAATCCAGGTCTGGTGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005894.1-781s1c1
Sequence:CCGGCCCTTTGACTTGAGACTAGTACTCGAGTACTAGTCTCAAGTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005894.2-1253s21c1
Sequence:CCGGTGATTATCCTCATACTCATTCCTCGAGGAATGAGTATGAGGATAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005894.2-1558s21c1
Sequence:CCGGTACTAATCTAGGTCCTATTACCTCGAGGTAATAGGACCTAGATTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005894.2-1171s21c1
Sequence:CCGGTCATCTGCTCAGGATAGTATCCTCGAGGATACTATCCTGAGCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks