EMAIL THIS PAGE TO A FRIEND

CD63

CD63 molecule

86 Gene Product Result for
Synonyms: LAMP-3 ME491 MLA1 OMA81H TSPAN30
UniProtKB ID: P08962, F8VZE2, Q5TZP3, Q8N6Z9, Q9UCG6
Gene ID:
Human(967) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The encoded protein is a cell surface glycoprotein that is known to complex with integrins. It may function as a blood platelet activation marker. Deficiency of this protein is associated with Hermansky-Pudlak syndrome. Also this gene has been associated with tumor progression. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Apr 2012]
Mouse(12512) CD63 antigen
Rat(29186) Cd63 molecule
sheep(101114944) CD63 molecule
Zebrafish(321461) Cd63 antigen
domestic cat(493846) CD63 molecule
cow(404156) CD63 molecule
dog(474391) CD63 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001780 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040034 Rosetta Predictions human pricing
NM_001780 siRNAs that have been validated in the lab human pricing
NM_017125 Rosetta Predictions rat pricing
NM_001042580 Rosetta Predictions mouse pricing
NM_007653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082309 predicted 330
2 SASI_Hs01_00082310 predicted 412
3 SASI_Hs01_00082313 predicted 411
4 SASI_Hs02_00308768 predicted 407
5 SASI_Hs02_00308769 predicted 488
6 SASI_Hs02_00308770 predicted 335
7 SASI_Hs02_00308771 predicted 429
8 SASI_Hs02_00308772 predicted 455
9 SASI_Hs01_00082307 predicted 404
10 SASI_Hs01_00082308 predicted 490
11 SASI_Hs01_00082306 predicted 439
12 SASI_Hs01_00082311 predicted 424
13 SASI_Hs01_00082312 predicted 485
14 SASI_Hs01_00082314 predicted 494
15 SASI_Hs01_00082315 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001780 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200108 validated 487
2 SASI_Hs01_00200109 predicted 331
3 SASI_Hs01_00200110 predicted 417
4 SASI_Hs01_00200113 predicted 406
5 SASI_Hs02_00332533 predicted 412
6 SASI_Hs02_00332534 predicted 491
7 SASI_Hs02_00332535 predicted 328
8 SASI_Hs02_00332536 predicted 429
9 SASI_Hs02_00332537 predicted 450
10 SASI_Hs01_00200107 predicted 403
11 SASI_Hs01_00200106 predicted 446
12 SASI_Hs01_00200111 predicted 427
13 SASI_Hs01_00200112 predicted 485
14 SASI_Hs01_00200114 predicted 502
15 SASI_Hs01_00200115 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049527 predicted 352
2 SASI_Rn01_00049528 predicted 361
3 SASI_Rn01_00049529 predicted 379
4 SASI_Rn01_00049530 predicted 291
5 SASI_Rn02_00261365 predicted 362
6 SASI_Rn01_00049531 predicted 289
7 SASI_Rn01_00049532 predicted 300
8 SASI_Rn01_00049533 predicted 423
9 SASI_Rn01_00049534 predicted 381
10 SASI_Rn01_00049535 predicted 212
11 SASI_Rn01_00049526 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290645 predicted 397
2 SASI_Mm02_00290646 predicted 399
3 SASI_Mm02_00290647 predicted 446
4 SASI_Mm02_00290648 predicted 369
5 SASI_Mm02_00290649 predicted 438
6 SASI_Mm02_00290650 predicted 385
7 SASI_Mm02_00290651 predicted 668
8 SASI_Mm02_00290652 predicted 503
9 SASI_Mm02_00290653 predicted 468
10 SASI_Mm02_00290654 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120250 predicted 363
2 SASI_Mm01_00120251 predicted 363
3 SASI_Mm01_00120252 predicted 398
4 SASI_Mm01_00120253 predicted 327
5 SASI_Mm01_00120254 predicted 406
6 SASI_Mm01_00120255 predicted 340
7 SASI_Mm01_00120256 predicted 630
8 SASI_Mm01_00120257 predicted 460
9 SASI_Mm01_00120258 predicted 434
10 SASI_Mm01_00120259 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007653
VALIDATED
CD63 MISSION shRNA Bacterial Glycerol Stock
CD63 molecule
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007653.2-631s1c1
Sequence:CCGGCCAGGTGAAGTCAGAGTTTAACTCGAGTTAAACTCTGACTTCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007653.2-550s1c1
Sequence:CCGGCATGATTACATTTGCCATCTTCTCGAGAAGATGGCAAATGTAATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007653.2-377s1c1
Sequence:CCGGGCAGTGGGATTGATCGCCATTCTCGAGAATGGCGATCAATCCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007653.2-876s1c1
Sequence:CCGGGCGTGGAGACTATAGCAATATCTCGAGATATTGCTATAGTCTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007653.2-413s1c1
Sequence:CCGGGTTGTCTTGAAGCAGGCCATTCTCGAGAATGGCCTGCTTCAAGACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007653.3-342s21c1
Sequence:GTACCGGTACTGTCTCATGATTACATTTCTCGAGAAATGTAATCATGAGACAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007653.3-406s21c1
Sequence:GTACCGGCCATTGCTGGCTATGTGTTTACTCGAGTAAACACATAGCCAGCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007653.3-431s21c1
Sequence:CCGGCCAGGTGAAGTCAGAGTTTAACTCGAGTTAAACTCTGACTTCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007653.3-177s21c1
Sequence:CCGGGCAGTGGGATTGATCGCCATTCTCGAGAATGGCGATCAATCCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007653.3-605s21c1
Sequence:CCGGTTCTTGCTGCATCAACATAACCTCGAGGTTATGTTGATGCAGCAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007653.3-468s21c1
Sequence:CCGGCAGATGCAGAATTACCTTAAACTCGAGTTTAAGGTAATTCTGCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007653.3-676s21c1
Sequence:CCGGGCGTGGAGACTATAGCAATATCTCGAGATATTGCTATAGTCTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007653
VALIDATED
CD63 MISSION shRNA shRNA Plasmid DNA
CD63 molecule
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007653.2-631s1c1
Sequence:CCGGCCAGGTGAAGTCAGAGTTTAACTCGAGTTAAACTCTGACTTCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007653.2-550s1c1
Sequence:CCGGCATGATTACATTTGCCATCTTCTCGAGAAGATGGCAAATGTAATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007653.2-377s1c1
Sequence:CCGGGCAGTGGGATTGATCGCCATTCTCGAGAATGGCGATCAATCCCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007653.2-876s1c1
Sequence:CCGGGCGTGGAGACTATAGCAATATCTCGAGATATTGCTATAGTCTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007653.2-413s1c1
Sequence:CCGGGTTGTCTTGAAGCAGGCCATTCTCGAGAATGGCCTGCTTCAAGACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007653.3-342s21c1
Sequence:GTACCGGTACTGTCTCATGATTACATTTCTCGAGAAATGTAATCATGAGACAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007653.3-406s21c1
Sequence:GTACCGGCCATTGCTGGCTATGTGTTTACTCGAGTAAACACATAGCCAGCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007653.3-431s21c1
Sequence:CCGGCCAGGTGAAGTCAGAGTTTAACTCGAGTTAAACTCTGACTTCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007653.3-177s21c1
Sequence:CCGGGCAGTGGGATTGATCGCCATTCTCGAGAATGGCGATCAATCCCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007653.3-605s21c1
Sequence:CCGGTTCTTGCTGCATCAACATAACCTCGAGGTTATGTTGATGCAGCAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007653.3-468s21c1
Sequence:CCGGCAGATGCAGAATTACCTTAAACTCGAGTTTAAGGTAATTCTGCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007653.3-676s21c1
Sequence:CCGGGCGTGGAGACTATAGCAATATCTCGAGATATTGCTATAGTCTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007653
VALIDATED
CD63 MISSION shRNA Lentiviral Transduction Particles
CD63 molecule
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007653.2-631s1c1
Sequence:CCGGCCAGGTGAAGTCAGAGTTTAACTCGAGTTAAACTCTGACTTCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007653.2-550s1c1
Sequence:CCGGCATGATTACATTTGCCATCTTCTCGAGAAGATGGCAAATGTAATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007653.2-377s1c1
Sequence:CCGGGCAGTGGGATTGATCGCCATTCTCGAGAATGGCGATCAATCCCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007653.2-876s1c1
Sequence:CCGGGCGTGGAGACTATAGCAATATCTCGAGATATTGCTATAGTCTCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007653.2-413s1c1
Sequence:CCGGGTTGTCTTGAAGCAGGCCATTCTCGAGAATGGCCTGCTTCAAGACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007653.3-342s21c1
Sequence:GTACCGGTACTGTCTCATGATTACATTTCTCGAGAAATGTAATCATGAGACAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007653.3-406s21c1
Sequence:GTACCGGCCATTGCTGGCTATGTGTTTACTCGAGTAAACACATAGCCAGCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007653.3-431s21c1
Sequence:CCGGCCAGGTGAAGTCAGAGTTTAACTCGAGTTAAACTCTGACTTCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007653.3-177s21c1
Sequence:CCGGGCAGTGGGATTGATCGCCATTCTCGAGAATGGCGATCAATCCCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007653.3-605s21c1
Sequence:CCGGTTCTTGCTGCATCAACATAACCTCGAGGTTATGTTGATGCAGCAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007653.3-468s21c1
Sequence:CCGGCAGATGCAGAATTACCTTAAACTCGAGTTTAAGGTAATTCTGCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007653.3-676s21c1
Sequence:CCGGGCGTGGAGACTATAGCAATATCTCGAGATATTGCTATAGTCTCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001780
VALIDATED
CD63 MISSION shRNA Bacterial Glycerol Stock
CD63 molecule
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001780.3-392s1c1
Sequence:CCGGGCTGGCTATGTGTTTAGAGATCTCGAGATCTCTAAACACATAGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001780.3-448s1c1
Sequence:CCGGGCAGATGGAGAATTACCCGAACTCGAGTTCGGGTAATTCTCCATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001780.3-616s1c1
Sequence:CCGGTGGGATTAATTTCAACGAGAACTCGAGTTCTCGTTGAAATTAATCCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001780.3-312s1c1
Sequence:CCGGGCAAGGAGAACTATTGTCTTACTCGAGTAAGACAATAGTTCTCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001780.3-762s1c1
Sequence:CCGGGCCTCGTGAAGAGTATCAGAACTCGAGTTCTGATACTCTTCACGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-626s21c1
Sequence:GTACCGGGGCTGCTAACTACACAGATTGCTCGAGCAATCTGTGTAGTTAGCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-728s21c1
Sequence:GTACCGGCAACGAGAAGGCGATCCATAACTCGAGTTATGGATCGCCTTCTCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-862s21c1
Sequence:CCGGGCCTCGTGAAGAGTATCAGAACTCGAGTTCTGATACTCTTCACGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-297s21c1
Sequence:CCGGGTCCTGAGTCAGACCATAATCCTCGAGGATTATGGTCTGACTCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-492s21c1
Sequence:CCGGGCTGGCTATGTGTTTAGAGATCTCGAGATCTCTAAACACATAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-681s21c1
Sequence:CCGGCCCGACTCCTGCTGCATTAATCTCGAGATTAATGCAGCAGGAGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-412s21c1
Sequence:CCGGGCAAGGAGAACTATTGTCTTACTCGAGTAAGACAATAGTTCTCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-514s21c1
Sequence:GTACCGGAGGTGATGTCAGAGTTTAATACTCGAGTATTAAACTCTGACATCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001780
VALIDATED
CD63 MISSION shRNA shRNA Plasmid DNA
CD63 molecule
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001780.3-392s1c1
Sequence:CCGGGCTGGCTATGTGTTTAGAGATCTCGAGATCTCTAAACACATAGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001780.3-448s1c1
Sequence:CCGGGCAGATGGAGAATTACCCGAACTCGAGTTCGGGTAATTCTCCATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001780.3-616s1c1
Sequence:CCGGTGGGATTAATTTCAACGAGAACTCGAGTTCTCGTTGAAATTAATCCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001780.3-312s1c1
Sequence:CCGGGCAAGGAGAACTATTGTCTTACTCGAGTAAGACAATAGTTCTCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001780.3-762s1c1
Sequence:CCGGGCCTCGTGAAGAGTATCAGAACTCGAGTTCTGATACTCTTCACGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-626s21c1
Sequence:GTACCGGGGCTGCTAACTACACAGATTGCTCGAGCAATCTGTGTAGTTAGCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-728s21c1
Sequence:GTACCGGCAACGAGAAGGCGATCCATAACTCGAGTTATGGATCGCCTTCTCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-862s21c1
Sequence:CCGGGCCTCGTGAAGAGTATCAGAACTCGAGTTCTGATACTCTTCACGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-297s21c1
Sequence:CCGGGTCCTGAGTCAGACCATAATCCTCGAGGATTATGGTCTGACTCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-492s21c1
Sequence:CCGGGCTGGCTATGTGTTTAGAGATCTCGAGATCTCTAAACACATAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-681s21c1
Sequence:CCGGCCCGACTCCTGCTGCATTAATCTCGAGATTAATGCAGCAGGAGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-412s21c1
Sequence:CCGGGCAAGGAGAACTATTGTCTTACTCGAGTAAGACAATAGTTCTCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-514s21c1
Sequence:GTACCGGAGGTGATGTCAGAGTTTAATACTCGAGTATTAAACTCTGACATCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001780
VALIDATED
CD63 MISSION shRNA Lentiviral Transduction Particles
CD63 molecule
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001780.3-392s1c1
Sequence:CCGGGCTGGCTATGTGTTTAGAGATCTCGAGATCTCTAAACACATAGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001780.3-448s1c1
Sequence:CCGGGCAGATGGAGAATTACCCGAACTCGAGTTCGGGTAATTCTCCATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001780.3-616s1c1
Sequence:CCGGTGGGATTAATTTCAACGAGAACTCGAGTTCTCGTTGAAATTAATCCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001780.3-312s1c1
Sequence:CCGGGCAAGGAGAACTATTGTCTTACTCGAGTAAGACAATAGTTCTCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001780.3-762s1c1
Sequence:CCGGGCCTCGTGAAGAGTATCAGAACTCGAGTTCTGATACTCTTCACGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-626s21c1
Sequence:GTACCGGGGCTGCTAACTACACAGATTGCTCGAGCAATCTGTGTAGTTAGCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-728s21c1
Sequence:GTACCGGCAACGAGAAGGCGATCCATAACTCGAGTTATGGATCGCCTTCTCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-862s21c1
Sequence:CCGGGCCTCGTGAAGAGTATCAGAACTCGAGTTCTGATACTCTTCACGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-297s21c1
Sequence:CCGGGTCCTGAGTCAGACCATAATCCTCGAGGATTATGGTCTGACTCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-492s21c1
Sequence:CCGGGCTGGCTATGTGTTTAGAGATCTCGAGATCTCTAAACACATAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-681s21c1
Sequence:CCGGCCCGACTCCTGCTGCATTAATCTCGAGATTAATGCAGCAGGAGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-412s21c1
Sequence:CCGGGCAAGGAGAACTATTGTCTTACTCGAGTAAGACAATAGTTCTCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001780.4-514s21c1
Sequence:GTACCGGAGGTGATGTCAGAGTTTAATACTCGAGTATTAAACTCTGACATCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)