EMAIL THIS PAGE TO A FRIEND

CD68

CD68 molecule

83 Gene Product Result for
Synonyms: GP110 LAMP4 SCARD1
UniProtKB ID: P34810, B4DVT4, Q53HR6, Q53XI3, Q96BI7
Gene ID:
Human(968) Summary: This gene encodes a 110-kD transmembrane glycoprotein that is highly expressed by human monocytes and tissue macrophages. It is a member of the lysosomal/endosomal-associated membrane glycoprotein (LAMP) family. The protein primarily localizes to lysosomes and endosomes with a smaller fraction circulating to the cell surface. It is a type I integral membrane protein with a heavily glycosylated extracellular domain and binds to tissue- and organ-specific lectins or selectins. The protein is also a member of the scavenger receptor family. Scavenger receptors typically function to clear cellular debris, promote phagocytosis, and mediate the recruitment and activation of macrophages. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(12514) CD68 antigen
Rat(287435) Cd68 molecule
sheep(101102500) CD68 molecule
cow(504960) CD68 molecule
Horse(100034045) CD68 molecule
domestic cat(101099002) CD68 molecule
dog(489476) CD68 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303885 ANTI-CD68 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
SAB1401062 Anti-CD68 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108444 Anti-CD68 antibody produced in rabbit affinity isolated antibody guinea pig, human
western blot pricing
SAB2700244 Anti-CD68 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA048982 Anti-CD68 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2107746 Anti-CD68 antibody produced in rabbit affinity isolated antibody, lyophilized powder human
ELISA, western blot pricing
SAB2107747 Anti-CD68 antibody produced in rabbit affinity isolated antibody human, horse
ELISA, western blot pricing
SAB5500070 Anti-CD68 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP251, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB1305013 ANTI-CD68/CD68 (KPI) (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AMAB90873 Monoclonal Anti-CD68 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1338, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry pricing
AMAB90874 Monoclonal Anti-CD68 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1346, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001251 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040059 Rosetta Predictions human pricing
NM_001251 Rosetta Predictions human pricing
NM_001031638 Rosetta Predictions rat pricing
XM_001079491 Rosetta Predictions rat pricing
NM_009853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213628 predicted 818
2 SASI_Hs01_00213630 predicted 578
3 SASI_Hs01_00213631 predicted 937
4 SASI_Hs02_00308780 predicted 770
5 SASI_Hs01_00213633 predicted 868
6 SASI_Hs01_00213634 predicted 629
7 SASI_Hs01_00213635 predicted 633
8 SASI_Hs01_00213636 predicted 944
9 SASI_Hs01_00213637 predicted 881
10 SASI_Hs02_00308781 predicted 759
11 SASI_Hs01_00213629 predicted 631
12 SASI_Hs01_00213632 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173416 predicted 902
2 SASI_Hs01_00173418 predicted 658
3 SASI_Hs01_00173419 predicted 1014
4 SASI_Hs02_00331429 predicted 853
5 SASI_Hs01_00173421 predicted 953
6 SASI_Hs01_00173422 predicted 718
7 SASI_Hs01_00173423 predicted 706
8 SASI_Hs01_00173424 predicted 1030
9 SASI_Hs01_00173425 predicted 962
10 SASI_Hs02_00331430 predicted 842
11 SASI_Hs01_00173417 predicted 708
12 SASI_Hs01_00173420 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039785 predicted 629
2 SASI_Rn01_00039786 predicted 801
3 SASI_Rn01_00039787 predicted 651
4 SASI_Rn01_00039788 predicted 899
5 SASI_Rn01_00039789 predicted 893
6 SASI_Rn01_00039790 predicted 890
7 SASI_Rn01_00039791 predicted 811
8 SASI_Rn01_00039792 predicted 630
9 SASI_Rn01_00039793 predicted 747
10 SASI_Rn01_00039794 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364510 predicted 634
2 SASI_Rn02_00364511 predicted 812
3 SASI_Rn02_00364512 predicted 662
4 SASI_Rn02_00364513 predicted 908
5 SASI_Rn02_00364514 predicted 894
6 SASI_Rn02_00364515 predicted 897
7 SASI_Rn02_00364516 predicted 823
8 SASI_Rn02_00364517 predicted 637
9 SASI_Rn02_00364518 predicted 754
10 SASI_Rn02_00364519 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093972 predicted 636
2 SASI_Mm01_00093973 predicted 595
3 SASI_Mm01_00093974 predicted 457
4 SASI_Mm01_00093975 predicted 203
5 SASI_Mm01_00093976 predicted 464
6 SASI_Mm01_00093977 predicted 421
7 SASI_Mm01_00093978 predicted 449
8 SASI_Mm01_00093979 predicted 205
9 SASI_Mm01_00093980 predicted 600
10 SASI_Mm01_00093981 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001251
VALIDATED
CD68 MISSION shRNA Bacterial Glycerol Stock
CD68 molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001251.2-971s21c1
Sequence:CCGGGAATGCATCCCTTCGAGATCTCTCGAGAGATCTCGAAGGGATGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001251.2-1251s21c1
Sequence:CCGGCTCTGAGCATTTGCTTCAAACCTCGAGGTTTGAAGCAAATGCTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001251.2-668s21c1
Sequence:CCGGCTACACGTGGACCAATGGTTCCTCGAGGAACCATTGGTCCACGTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001251.2-1534s21c1
Sequence:CCGGTAATCCCAGCTGGCCTGTAATCTCGAGATTACAGGCCAGCTGGGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-537s1c1
Sequence:CCGGCCAGATTCAGATTCGAGTCATCTCGAGATGACTCGAATCTGAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-1026s1c1
Sequence:CCGGGCTTATTGCTTTCTGCATCATCTCGAGATGATGCAGAAAGCAATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-670s1c1
Sequence:CCGGCCCTATGGACACCTCAGCTTTCTCGAGAAAGCTGAGGTGTCCATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-271s1c1
Sequence:CCGGCATGGAAACGTCACAGTTCATCTCGAGATGAACTGTGACGTTTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-349s1c1
Sequence:CCGGGCCACCACTAGTCATGGAAATCTCGAGATTTCCATGACTAGTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001251
VALIDATED
CD68 MISSION shRNA shRNA Plasmid DNA
CD68 molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001251.2-971s21c1
Sequence:CCGGGAATGCATCCCTTCGAGATCTCTCGAGAGATCTCGAAGGGATGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001251.2-1251s21c1
Sequence:CCGGCTCTGAGCATTTGCTTCAAACCTCGAGGTTTGAAGCAAATGCTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001251.2-668s21c1
Sequence:CCGGCTACACGTGGACCAATGGTTCCTCGAGGAACCATTGGTCCACGTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001251.2-1534s21c1
Sequence:CCGGTAATCCCAGCTGGCCTGTAATCTCGAGATTACAGGCCAGCTGGGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-537s1c1
Sequence:CCGGCCAGATTCAGATTCGAGTCATCTCGAGATGACTCGAATCTGAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-1026s1c1
Sequence:CCGGGCTTATTGCTTTCTGCATCATCTCGAGATGATGCAGAAAGCAATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-670s1c1
Sequence:CCGGCCCTATGGACACCTCAGCTTTCTCGAGAAAGCTGAGGTGTCCATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-271s1c1
Sequence:CCGGCATGGAAACGTCACAGTTCATCTCGAGATGAACTGTGACGTTTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-349s1c1
Sequence:CCGGGCCACCACTAGTCATGGAAATCTCGAGATTTCCATGACTAGTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001251
VALIDATED
CD68 MISSION shRNA Lentiviral Transduction Particles
CD68 molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001251.2-971s21c1
Sequence:CCGGGAATGCATCCCTTCGAGATCTCTCGAGAGATCTCGAAGGGATGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001251.2-1251s21c1
Sequence:CCGGCTCTGAGCATTTGCTTCAAACCTCGAGGTTTGAAGCAAATGCTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001251.2-668s21c1
Sequence:CCGGCTACACGTGGACCAATGGTTCCTCGAGGAACCATTGGTCCACGTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001251.2-1534s21c1
Sequence:CCGGTAATCCCAGCTGGCCTGTAATCTCGAGATTACAGGCCAGCTGGGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-537s1c1
Sequence:CCGGCCAGATTCAGATTCGAGTCATCTCGAGATGACTCGAATCTGAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-1026s1c1
Sequence:CCGGGCTTATTGCTTTCTGCATCATCTCGAGATGATGCAGAAAGCAATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-670s1c1
Sequence:CCGGCCCTATGGACACCTCAGCTTTCTCGAGAAAGCTGAGGTGTCCATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-271s1c1
Sequence:CCGGCATGGAAACGTCACAGTTCATCTCGAGATGAACTGTGACGTTTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001251.1-349s1c1
Sequence:CCGGGCCACCACTAGTCATGGAAATCTCGAGATTTCCATGACTAGTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009853
VALIDATED
CD68 MISSION shRNA Bacterial Glycerol Stock
CD68 molecule
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-592s21c1
Sequence:CCGGCCTTATGGACAGCTTACCTTTCTCGAGAAAGGTAAGCTGTCCATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-169s21c1
Sequence:CCGGAGTCACGGAAATGTCACAGTTCTCGAGAACTGTGACATTTCCGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-456s21c1
Sequence:CCGGCCCAATTCAGGGTGGAAGAAACTCGAGTTTCTTCCACCCTGAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-668s21c1
Sequence:CCGGCGGTGGAATACAATGTGTCCTCTCGAGAGGACACATTGTATTCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-242s21c1
Sequence:CCGGGTCATGGGAATGCCACAATTTCTCGAGAAATTGTGGCATTCCCATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-433s1c1
Sequence:CCGGCAAATTCAAATCCGAATCCTACTCGAGTAGGATTCGGATTTGAATTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-592s1c1
Sequence:CCGGCCTTATGGACAGCTTACCTTTCTCGAGAAAGGTAAGCTGTCCATAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-769s1c1
Sequence:CCGGTGCTGTGGAAATGCAAGCATACTCGAGTATGCTTGCATTTCCACAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-706s1c1
Sequence:CCGGTGGACATTCATGGCGCAGAATCTCGAGATTCTGCGCCATGAATGTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009853.1-242s1c1
Sequence:CCGGGTCATGGGAATGCCACAATTTCTCGAGAAATTGTGGCATTCCCATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-55s1c1
Sequence:CCGGGAGGAAGACTGTCCTCACAAACTCGAGTTTGTGAGGACAGTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-456s1c1
Sequence:CCGGCCCAATTCAGGGTGGAAGAAACTCGAGTTTCTTCCACCCTGAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009853.1-32s1c1
Sequence:CCGGGACCGCTTATAGCCCAAGGAACTCGAGTTCCTTGGGCTATAAGCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-668s1c1
Sequence:CCGGCGGTGGAATACAATGTGTCCTCTCGAGAGGACACATTGTATTCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-169s1c1
Sequence:CCGGAGTCACGGAAATGTCACAGTTCTCGAGAACTGTGACATTTCCGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009853
VALIDATED
CD68 MISSION shRNA shRNA Plasmid DNA
CD68 molecule
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-592s21c1
Sequence:CCGGCCTTATGGACAGCTTACCTTTCTCGAGAAAGGTAAGCTGTCCATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-169s21c1
Sequence:CCGGAGTCACGGAAATGTCACAGTTCTCGAGAACTGTGACATTTCCGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-456s21c1
Sequence:CCGGCCCAATTCAGGGTGGAAGAAACTCGAGTTTCTTCCACCCTGAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-668s21c1
Sequence:CCGGCGGTGGAATACAATGTGTCCTCTCGAGAGGACACATTGTATTCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-242s21c1
Sequence:CCGGGTCATGGGAATGCCACAATTTCTCGAGAAATTGTGGCATTCCCATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-433s1c1
Sequence:CCGGCAAATTCAAATCCGAATCCTACTCGAGTAGGATTCGGATTTGAATTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-592s1c1
Sequence:CCGGCCTTATGGACAGCTTACCTTTCTCGAGAAAGGTAAGCTGTCCATAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-769s1c1
Sequence:CCGGTGCTGTGGAAATGCAAGCATACTCGAGTATGCTTGCATTTCCACAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-706s1c1
Sequence:CCGGTGGACATTCATGGCGCAGAATCTCGAGATTCTGCGCCATGAATGTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009853.1-242s1c1
Sequence:CCGGGTCATGGGAATGCCACAATTTCTCGAGAAATTGTGGCATTCCCATGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-55s1c1
Sequence:CCGGGAGGAAGACTGTCCTCACAAACTCGAGTTTGTGAGGACAGTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-456s1c1
Sequence:CCGGCCCAATTCAGGGTGGAAGAAACTCGAGTTTCTTCCACCCTGAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009853.1-32s1c1
Sequence:CCGGGACCGCTTATAGCCCAAGGAACTCGAGTTCCTTGGGCTATAAGCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-668s1c1
Sequence:CCGGCGGTGGAATACAATGTGTCCTCTCGAGAGGACACATTGTATTCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-169s1c1
Sequence:CCGGAGTCACGGAAATGTCACAGTTCTCGAGAACTGTGACATTTCCGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009853
VALIDATED
CD68 MISSION shRNA Lentiviral Transduction Particles
CD68 molecule
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-592s21c1
Sequence:CCGGCCTTATGGACAGCTTACCTTTCTCGAGAAAGGTAAGCTGTCCATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-169s21c1
Sequence:CCGGAGTCACGGAAATGTCACAGTTCTCGAGAACTGTGACATTTCCGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-456s21c1
Sequence:CCGGCCCAATTCAGGGTGGAAGAAACTCGAGTTTCTTCCACCCTGAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-668s21c1
Sequence:CCGGCGGTGGAATACAATGTGTCCTCTCGAGAGGACACATTGTATTCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009853.1-242s21c1
Sequence:CCGGGTCATGGGAATGCCACAATTTCTCGAGAAATTGTGGCATTCCCATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-433s1c1
Sequence:CCGGCAAATTCAAATCCGAATCCTACTCGAGTAGGATTCGGATTTGAATTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-592s1c1
Sequence:CCGGCCTTATGGACAGCTTACCTTTCTCGAGAAAGGTAAGCTGTCCATAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-769s1c1
Sequence:CCGGTGCTGTGGAAATGCAAGCATACTCGAGTATGCTTGCATTTCCACAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-706s1c1
Sequence:CCGGTGGACATTCATGGCGCAGAATCTCGAGATTCTGCGCCATGAATGTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009853.1-242s1c1
Sequence:CCGGGTCATGGGAATGCCACAATTTCTCGAGAAATTGTGGCATTCCCATGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-55s1c1
Sequence:CCGGGAGGAAGACTGTCCTCACAAACTCGAGTTTGTGAGGACAGTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-456s1c1
Sequence:CCGGCCCAATTCAGGGTGGAAGAAACTCGAGTTTCTTCCACCCTGAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009853.1-32s1c1
Sequence:CCGGGACCGCTTATAGCCCAAGGAACTCGAGTTCCTTGGGCTATAAGCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-668s1c1
Sequence:CCGGCGGTGGAATACAATGTGTCCTCTCGAGAGGACACATTGTATTCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009853.1-169s1c1
Sequence:CCGGAGTCACGGAAATGTCACAGTTCTCGAGAACTGTGACATTTCCGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)