EMAIL THIS PAGE TO A FRIEND

CD69

CD69 molecule

149 Gene Product Result for
Synonyms: AIM BL-AC/P26 CLEC2C EA1 GP32/28 MLR-3
UniProtKB ID: Q07108
Gene ID:
Human(969) Summary: This gene encodes a member of the calcium dependent lectin superfamily of type II transmembrane receptors. Expression of the encoded protein is induced upon activation of T lymphocytes, and may play a role in proliferation. Furthermore, the protein may act to transmit signals in natural killer cells and platelets. [provided by RefSeq, Aug 2011]
Mouse(12515) CD69 antigen
Rat(29187) Cd69 molecule
chicken(417816) CD69 molecule
cow(281058) CD69 molecule
domestic cat(101082498) CD69 molecule
dog(477698) CD69 molecule
sheep(443215) CD69 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1349 Human CD69 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001781 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_132882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001781 Rosetta Predictions human pricing
NM_134327 Rosetta Predictions rat pricing
NM_001033122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332538 predicted 430
2 SASI_Hs01_00111754 predicted 1065
3 SASI_Hs01_00111756 predicted 247
4 SASI_Hs01_00111758 predicted 1106
5 SASI_Hs01_00111759 predicted 318
6 SASI_Hs01_00111760 predicted 1069
7 SASI_Hs01_00111761 predicted 1078
8 SASI_Hs02_00332539 predicted 558
9 SASI_Hs01_00111763 predicted 1072
10 SASI_Hs02_00332540 predicted 258
11 SASI_Hs01_00111755 predicted 1167
12 SASI_Hs01_00111757 predicted 1053
13 SASI_Hs01_00111762 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095811 predicted 537
2 SASI_Rn01_00095812 predicted 943
3 SASI_Rn01_00095813 predicted 897
4 SASI_Rn01_00095814 predicted 759
5 SASI_Rn01_00095815 predicted 528
6 SASI_Rn02_00267868 predicted 230
7 SASI_Rn01_00095817 predicted 752
8 SASI_Rn01_00095818 predicted 455
9 SASI_Rn01_00095819 predicted 520
10 SASI_Rn01_00095820 predicted 805
11 SASI_Rn01_00095816 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125429 predicted 1165
2 SASI_Mm01_00125430 predicted 1162
3 SASI_Mm01_00125431 predicted 432
4 SASI_Mm01_00125432 predicted 338
5 SASI_Mm02_00288176 predicted 1167
6 SASI_Mm01_00125433 predicted 676
7 SASI_Mm01_00125434 predicted 724
8 SASI_Mm01_00125435 predicted 1166
9 SASI_Mm01_00125436 predicted 483
10 SASI_Mm01_00125438 predicted 288
11 SASI_Mm01_00125437 predicted 1177
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001781
CD69 MISSION shRNA Bacterial Glycerol Stock
CD69 molecule
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001781.1-1441s1c1
Sequence:CCGGGCAATATGTGATGTGGCAAATCTCGAGATTTGCCACATCACATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001781.1-288s1c1
Sequence:CCGGAGGCCAATACACATTCTCAATCTCGAGATTGAGAATGTGTATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001781.1-434s1c1
Sequence:CCGGCTACTCTTGCTGTCATTGATTCTCGAGAATCAATGACAGCAAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001781.1-543s1c1
Sequence:CCGGGTGGTCAAATGGCAAAGAATTCTCGAGAATTCTTTGCCATTTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001781.1-629s1c1
Sequence:CCGGGCATGGAATGTGAGAAGAATTCTCGAGAATTCTTCTCACATTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001781.2-203s21c1
Sequence:CCGGTCCTGTGTGCTGTAATGAATGCTCGAGCATTCATTACAGCACACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001781.2-690s21c1
Sequence:CCGGCATGTTCACTTATTGACTATTCTCGAGAATAGTCAATAAGTGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001781
CD69 MISSION shRNA shRNA Plasmid DNA
CD69 molecule
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001781.1-1441s1c1
Sequence:CCGGGCAATATGTGATGTGGCAAATCTCGAGATTTGCCACATCACATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001781.1-288s1c1
Sequence:CCGGAGGCCAATACACATTCTCAATCTCGAGATTGAGAATGTGTATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001781.1-434s1c1
Sequence:CCGGCTACTCTTGCTGTCATTGATTCTCGAGAATCAATGACAGCAAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001781.1-543s1c1
Sequence:CCGGGTGGTCAAATGGCAAAGAATTCTCGAGAATTCTTTGCCATTTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001781.1-629s1c1
Sequence:CCGGGCATGGAATGTGAGAAGAATTCTCGAGAATTCTTCTCACATTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001781.2-203s21c1
Sequence:CCGGTCCTGTGTGCTGTAATGAATGCTCGAGCATTCATTACAGCACACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001781.2-690s21c1
Sequence:CCGGCATGTTCACTTATTGACTATTCTCGAGAATAGTCAATAAGTGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001781
CD69 MISSION shRNA Lentiviral Transduction Particles
CD69 molecule
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001781.1-1441s1c1
Sequence:CCGGGCAATATGTGATGTGGCAAATCTCGAGATTTGCCACATCACATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001781.1-288s1c1
Sequence:CCGGAGGCCAATACACATTCTCAATCTCGAGATTGAGAATGTGTATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001781.1-434s1c1
Sequence:CCGGCTACTCTTGCTGTCATTGATTCTCGAGAATCAATGACAGCAAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001781.1-543s1c1
Sequence:CCGGGTGGTCAAATGGCAAAGAATTCTCGAGAATTCTTTGCCATTTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001781.1-629s1c1
Sequence:CCGGGCATGGAATGTGAGAAGAATTCTCGAGAATTCTTCTCACATTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001781.2-203s21c1
Sequence:CCGGTCCTGTGTGCTGTAATGAATGCTCGAGCATTCATTACAGCACACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001781.2-690s21c1
Sequence:CCGGCATGTTCACTTATTGACTATTCTCGAGAATAGTCAATAAGTGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132882
CD69 MISSION shRNA Bacterial Glycerol Stock
CD69 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132882.2-191s1c1
Sequence:CCGGCCATTCAAGTTTCTATCCCTTCTCGAGAAGGGATAGAAACTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132882.2-433s1c1
Sequence:CCGGGCTGCTACTCTTGCTGTAATTCTCGAGAATTACAGCAAGAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132882.2-685s1c1
Sequence:CCGGCGAGGATACATAGATGTATAACTCGAGTTATACATCTATGTATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132882.2-324s1c1
Sequence:CCGGCCATGTTGCTACCTGCAAGAACTCGAGTTCTTGCAGGTAGCAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132882.2-1449s1c1
Sequence:CCGGCCTTGGAATAACTCCAGTCTTCTCGAGAAGACTGGAGTTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132882
CD69 MISSION shRNA shRNA Plasmid DNA
CD69 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132882.2-191s1c1
Sequence:CCGGCCATTCAAGTTTCTATCCCTTCTCGAGAAGGGATAGAAACTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132882.2-433s1c1
Sequence:CCGGGCTGCTACTCTTGCTGTAATTCTCGAGAATTACAGCAAGAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132882.2-685s1c1
Sequence:CCGGCGAGGATACATAGATGTATAACTCGAGTTATACATCTATGTATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132882.2-324s1c1
Sequence:CCGGCCATGTTGCTACCTGCAAGAACTCGAGTTCTTGCAGGTAGCAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132882.2-1449s1c1
Sequence:CCGGCCTTGGAATAACTCCAGTCTTCTCGAGAAGACTGGAGTTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132882
CD69 MISSION shRNA Lentiviral Transduction Particles
CD69 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132882.2-191s1c1
Sequence:CCGGCCATTCAAGTTTCTATCCCTTCTCGAGAAGGGATAGAAACTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132882.2-433s1c1
Sequence:CCGGGCTGCTACTCTTGCTGTAATTCTCGAGAATTACAGCAAGAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132882.2-685s1c1
Sequence:CCGGCGAGGATACATAGATGTATAACTCGAGTTATACATCTATGTATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132882.2-324s1c1
Sequence:CCGGCCATGTTGCTACCTGCAAGAACTCGAGTTCTTGCAGGTAGCAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132882.2-1449s1c1
Sequence:CCGGCCTTGGAATAACTCCAGTCTTCTCGAGAAGACTGGAGTTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks