EMAIL THIS PAGE TO A FRIEND

CD6

CD6 molecule

114 Gene Product Result for
Synonyms: TP120
UniProtKB ID: P30203, Q9UMF2, Q9Y4K7, Q9Y4K8, Q9Y4K9, Q9Y4L0
Gene ID:
Human(923) Summary: This gene encodes a protein found on the outer membrane of T-lymphocytes as well as some other immune cells. The encoded protein contains three scavenger receptor cysteine-rich (SRCR) domains and a binding site for an activated leukocyte cell adhesion molecule. The gene product is important for continuation of T cell activation. This gene may be associated with susceptibility to multiple sclerosis (PMID: 19525953, 21849685). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(12511) CD6 antigen
Rat(25752) Cd6 molecule
chicken(101665115) CD6 molecule
dog(483804) CD6 molecule
cow(282881) CD6 molecule
Horse(100062081) CD6 molecule
chicken(101748655) CD6 molecule
sheep(101122317) CD6 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006725 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006725 Rosetta Predictions human pricing
NM_175577 Rosetta Predictions rat pricing
NM_001037801 Rosetta Predictions mouse pricing
NM_009852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185432 predicted 613
2 SASI_Hs01_00185433 predicted 1289
3 SASI_Hs01_00185434 predicted 1613
4 SASI_Hs01_00185435 predicted 1429
5 SASI_Hs01_00185436 predicted 1277
6 SASI_Hs01_00185437 predicted 1657
7 SASI_Hs02_00342160 predicted 1288
8 SASI_Hs01_00185438 predicted 1282
9 SASI_Hs01_00185439 predicted 2131
10 SASI_Hs01_00185441 predicted 1163
11 SASI_Hs01_00185440 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102579 predicted 1648
2 SASI_Rn01_00102580 predicted 1455
3 SASI_Rn02_00269477 predicted 1241
4 SASI_Rn01_00102581 predicted 1416
5 SASI_Rn01_00102582 predicted 1721
6 SASI_Rn01_00102583 predicted 1856
7 SASI_Rn01_00102584 predicted 1807
8 SASI_Rn01_00102585 predicted 2118
9 SASI_Rn01_00102586 predicted 235
10 SASI_Rn01_00102587 predicted 1362
11 SASI_Rn01_00102588 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289437 predicted 2529
2 SASI_Mm02_00289438 predicted 362
3 SASI_Mm02_00289439 predicted 2534
4 SASI_Mm01_00101741 predicted 1319
5 SASI_Mm02_00289440 predicted 2480
6 SASI_Mm02_00289441 predicted 2310
7 SASI_Mm02_00289442 predicted 299
8 SASI_Mm01_00101744 predicted 453
9 SASI_Mm02_00289443 predicted 2332
10 SASI_Mm02_00289444 predicted 2256
11 SASI_Mm01_00101736 predicted 1133
12 SASI_Mm01_00101737 predicted 1215
13 SASI_Mm01_00101738 predicted 1721
14 SASI_Mm01_00101739 predicted 315
15 SASI_Mm01_00101740 predicted 285
16 SASI_Mm01_00101742 predicted 1241
17 SASI_Mm01_00101743 predicted 1207
18 SASI_Mm01_00101745 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317236 predicted 2640
2 SASI_Mm02_00317237 predicted 368
3 SASI_Mm02_00317238 predicted 2644
4 SASI_Mm01_00142635 predicted 1322
5 SASI_Mm02_00317239 predicted 2594
6 SASI_Mm02_00317240 predicted 2431
7 SASI_Mm02_00317241 predicted 294
8 SASI_Mm01_00142638 predicted 451
9 SASI_Mm02_00317242 predicted 2455
10 SASI_Mm02_00317243 predicted 2370
11 SASI_Mm01_00142630 predicted 1218
12 SASI_Mm01_00142631 predicted 1307
13 SASI_Mm01_00142632 predicted 1935
14 SASI_Mm01_00142633 predicted 406
15 SASI_Mm01_00142634 predicted 374
16 SASI_Mm01_00142636 predicted 1340
17 SASI_Mm01_00142637 predicted 1302
18 SASI_Mm01_00142639 predicted 1216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006725
VALIDATED
CD6 MISSION shRNA Bacterial Glycerol Stock
CD6 molecule
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006725.3-2700s21c1
Sequence:CCGGTAGGGTCTGCTGAGCTGTTGTCTCGAGACAACAGCTCAGCAGACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-2193s21c1
Sequence:CCGGCCGACAACGATGACTACGATGCTCGAGCATCGTAGTCATCGTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-1191s21c1
Sequence:CCGGCCGGCAGGATGTACTACTCATCTCGAGATGAGTAGTACATCCTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-1404s21c1
Sequence:CCGGAGGAATCTCGGGAGCTAATGCCTCGAGGCATTAGCTCCCGAGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-558s21c1
Sequence:CCGGACACCAGCGTAGCAGCTAATGCTCGAGCATTAGCTGCTACGCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-1312s21c1
Sequence:CCGGCCGGAGTTTGCACAATCTGTCCTCGAGGACAGATTGTGCAAACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-1887s21c1
Sequence:CCGGAGTATCACCCGAGGAGCAACACTCGAGTGTTGCTCCTCGGGTGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_006725.2-2539s1c1
Sequence:CCGGGCGCTTTGATTGCCTGAGTTTCTCGAGAAACTCAGGCAATCAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_006725.2-1875s1c1
Sequence:CCGGGATTACTGCAATAGTCCCAAACTCGAGTTTGGGACTATTGCAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006725.2-1430s1c1
Sequence:CCGGCCTCTTGAGAATTAAAGGAAACTCGAGTTTCCTTTAATTCTCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006725.2-1374s1c1
Sequence:CCGGCCCTCCATCGTTCTGGGAATTCTCGAGAATTCCCAGAACGATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_006725.2-1503s1c1
Sequence:CCGGGCAGGGAGCAATAGCTATCAACTCGAGTTGATAGCTATTGCTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006725
VALIDATED
CD6 MISSION shRNA shRNA Plasmid DNA
CD6 molecule
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006725.3-2700s21c1
Sequence:CCGGTAGGGTCTGCTGAGCTGTTGTCTCGAGACAACAGCTCAGCAGACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-2193s21c1
Sequence:CCGGCCGACAACGATGACTACGATGCTCGAGCATCGTAGTCATCGTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-1191s21c1
Sequence:CCGGCCGGCAGGATGTACTACTCATCTCGAGATGAGTAGTACATCCTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-1404s21c1
Sequence:CCGGAGGAATCTCGGGAGCTAATGCCTCGAGGCATTAGCTCCCGAGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-558s21c1
Sequence:CCGGACACCAGCGTAGCAGCTAATGCTCGAGCATTAGCTGCTACGCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-1312s21c1
Sequence:CCGGCCGGAGTTTGCACAATCTGTCCTCGAGGACAGATTGTGCAAACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-1887s21c1
Sequence:CCGGAGTATCACCCGAGGAGCAACACTCGAGTGTTGCTCCTCGGGTGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_006725.2-2539s1c1
Sequence:CCGGGCGCTTTGATTGCCTGAGTTTCTCGAGAAACTCAGGCAATCAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_006725.2-1875s1c1
Sequence:CCGGGATTACTGCAATAGTCCCAAACTCGAGTTTGGGACTATTGCAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006725.2-1430s1c1
Sequence:CCGGCCTCTTGAGAATTAAAGGAAACTCGAGTTTCCTTTAATTCTCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006725.2-1374s1c1
Sequence:CCGGCCCTCCATCGTTCTGGGAATTCTCGAGAATTCCCAGAACGATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_006725.2-1503s1c1
Sequence:CCGGGCAGGGAGCAATAGCTATCAACTCGAGTTGATAGCTATTGCTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006725
VALIDATED
CD6 MISSION shRNA Lentiviral Transduction Particles
CD6 molecule
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006725.3-2700s21c1
Sequence:CCGGTAGGGTCTGCTGAGCTGTTGTCTCGAGACAACAGCTCAGCAGACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-2193s21c1
Sequence:CCGGCCGACAACGATGACTACGATGCTCGAGCATCGTAGTCATCGTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-1191s21c1
Sequence:CCGGCCGGCAGGATGTACTACTCATCTCGAGATGAGTAGTACATCCTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-1404s21c1
Sequence:CCGGAGGAATCTCGGGAGCTAATGCCTCGAGGCATTAGCTCCCGAGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-558s21c1
Sequence:CCGGACACCAGCGTAGCAGCTAATGCTCGAGCATTAGCTGCTACGCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-1312s21c1
Sequence:CCGGCCGGAGTTTGCACAATCTGTCCTCGAGGACAGATTGTGCAAACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006725.3-1887s21c1
Sequence:CCGGAGTATCACCCGAGGAGCAACACTCGAGTGTTGCTCCTCGGGTGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_006725.2-2539s1c1
Sequence:CCGGGCGCTTTGATTGCCTGAGTTTCTCGAGAAACTCAGGCAATCAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_006725.2-1875s1c1
Sequence:CCGGGATTACTGCAATAGTCCCAAACTCGAGTTTGGGACTATTGCAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006725.2-1430s1c1
Sequence:CCGGCCTCTTGAGAATTAAAGGAAACTCGAGTTTCCTTTAATTCTCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006725.2-1374s1c1
Sequence:CCGGCCCTCCATCGTTCTGGGAATTCTCGAGAATTCCCAGAACGATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_006725.2-1503s1c1
Sequence:CCGGGCAGGGAGCAATAGCTATCAACTCGAGTTGATAGCTATTGCTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009852
CD6 MISSION shRNA Bacterial Glycerol Stock
CD6 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009852.1-1492s1c1
Sequence:CCGGGCAGGGATCAATAACTACCATCTCGAGATGGTAGTTATTGATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009852.1-419s1c1
Sequence:CCGGGTGGTGATTCGGGAAAGGTTACTCGAGTAACCTTTCCCGAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009852.1-2218s1c1
Sequence:CCGGCCTTTCTCTATCCCTAGACAACTCGAGTTGTCTAGGGATAGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009852.1-1324s1c1
Sequence:CCGGGTGAAGGATAAGGACTCACAACTCGAGTTGTGAGTCCTTATCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009852.1-1519s1c1
Sequence:CCGGCCTATCACCATTGCCAAAGAACTCGAGTTCTTTGGCAATGGTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009852
CD6 MISSION shRNA shRNA Plasmid DNA
CD6 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009852.1-1492s1c1
Sequence:CCGGGCAGGGATCAATAACTACCATCTCGAGATGGTAGTTATTGATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009852.1-419s1c1
Sequence:CCGGGTGGTGATTCGGGAAAGGTTACTCGAGTAACCTTTCCCGAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009852.1-2218s1c1
Sequence:CCGGCCTTTCTCTATCCCTAGACAACTCGAGTTGTCTAGGGATAGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009852.1-1324s1c1
Sequence:CCGGGTGAAGGATAAGGACTCACAACTCGAGTTGTGAGTCCTTATCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009852.1-1519s1c1
Sequence:CCGGCCTATCACCATTGCCAAAGAACTCGAGTTCTTTGGCAATGGTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009852
CD6 MISSION shRNA Lentiviral Transduction Particles
CD6 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009852.1-1492s1c1
Sequence:CCGGGCAGGGATCAATAACTACCATCTCGAGATGGTAGTTATTGATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009852.1-419s1c1
Sequence:CCGGGTGGTGATTCGGGAAAGGTTACTCGAGTAACCTTTCCCGAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009852.1-2218s1c1
Sequence:CCGGCCTTTCTCTATCCCTAGACAACTCGAGTTGTCTAGGGATAGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009852.1-1324s1c1
Sequence:CCGGGTGAAGGATAAGGACTCACAACTCGAGTTGTGAGTCCTTATCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009852.1-1519s1c1
Sequence:CCGGCCTATCACCATTGCCAAAGAACTCGAGTTCTTTGGCAATGGTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks