EMAIL THIS PAGE TO A FRIEND

CD72

CD72 molecule

88 Gene Product Result for
Synonyms: CD72b LYB2
UniProtKB ID: P21854
Gene ID:
Mouse(12517) CD72 antigen
Rat(313498) Cd72 molecule
sheep(101108894) CD72 molecule
chicken(395923) CD72 molecule
cow(783725) CD72 molecule
domestic cat(101086759) CD72 molecule
dog(481595) CD72 molecule
chicken(427415) CD72 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001782 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019251 MISSION® esiRNA esiRNA targeting human CD72 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001782 Rosetta Predictions human pricing
NM_001015016 Rosetta Predictions rat pricing
NM_001110320 Rosetta Predictions mouse pricing
NM_001110321 Rosetta Predictions mouse pricing
NM_001110322 Rosetta Predictions mouse pricing
NM_007654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019482 predicted 915
2 SASI_Hs01_00019483 predicted 1022
3 SASI_Hs01_00019484 predicted 934
4 SASI_Hs01_00019486 predicted 1179
5 SASI_Hs01_00019487 predicted 1145
6 SASI_Hs01_00019488 predicted 900
7 SASI_Hs01_00019489 predicted 1005
8 SASI_Hs01_00019490 predicted 1191
9 SASI_Hs01_00019491 predicted 1153
10 SASI_Hs02_00332541 predicted 967
11 SASI_Hs01_00019485 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202023 predicted 953
2 SASI_Rn02_00202024 predicted 1211
3 SASI_Rn02_00202025 predicted 923
4 SASI_Rn02_00202026 predicted 865
5 SASI_Rn02_00202027 predicted 1180
6 SASI_Rn02_00202028 predicted 1061
7 SASI_Rn02_00202029 predicted 927
8 SASI_Rn02_00202030 predicted 950
9 SASI_Rn02_00202031 predicted 333
10 SASI_Rn02_00202032 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305378 predicted 1198
2 SASI_Mm02_00305379 predicted 1242
3 SASI_Mm02_00305380 predicted 652
4 SASI_Mm02_00305381 predicted 1164
5 SASI_Mm02_00305382 predicted 1200
6 SASI_Mm02_00305383 predicted 1160
7 SASI_Mm02_00305384 predicted 1172
8 SASI_Mm02_00305385 predicted 1203
9 SASI_Mm02_00305386 predicted 1269
10 SASI_Mm02_00305387 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305388 predicted 1128
2 SASI_Mm02_00305389 predicted 1170
3 SASI_Mm02_00305390 predicted 588
4 SASI_Mm02_00305391 predicted 1089
5 SASI_Mm02_00305392 predicted 1130
6 SASI_Mm02_00305393 predicted 1092
7 SASI_Mm02_00305394 predicted 1107
8 SASI_Mm02_00305395 predicted 1129
9 SASI_Mm02_00305396 predicted 1203
10 SASI_Mm02_00305397 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305398 predicted 1015
2 SASI_Mm02_00305399 predicted 1057
3 SASI_Mm02_00305400 predicted 493
4 SASI_Mm02_00305401 predicted 976
5 SASI_Mm02_00305402 predicted 1022
6 SASI_Mm02_00305403 predicted 984
7 SASI_Mm02_00305404 predicted 997
8 SASI_Mm02_00305405 predicted 1026
9 SASI_Mm02_00305406 predicted 1090
10 SASI_Mm02_00305407 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312142 predicted 1175
2 SASI_Mm02_00312143 predicted 1223
3 SASI_Mm02_00312144 predicted 655
4 SASI_Mm02_00312145 predicted 1138
5 SASI_Mm01_00101869 predicted 1177
6 SASI_Mm02_00312146 predicted 1140
7 SASI_Mm02_00312147 predicted 1159
8 SASI_Mm02_00312148 predicted 1185
9 SASI_Mm02_00312149 predicted 1254
10 SASI_Mm02_00312150 predicted 1242
11 SASI_Mm01_00101866 predicted 941
12 SASI_Mm01_00101867 predicted 863
13 SASI_Mm01_00101868 predicted 903
14 SASI_Mm01_00101870 predicted 851
15 SASI_Mm01_00101871 predicted 846
16 SASI_Mm01_00101872 predicted 958
17 SASI_Mm01_00101873 predicted 1086
18 SASI_Mm01_00101874 predicted 969
19 SASI_Mm01_00101875 predicted 771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001782
CD72 MISSION shRNA Bacterial Glycerol Stock
CD72 molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001782.2-441s21c1
Sequence:CCGGTGTTAGGAGTGACCGCCATCTCTCGAGAGATGGCGGTCACTCCTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001782.2-929s21c1
Sequence:CCGGGCCACATTCAGTGAAATTTATCTCGAGATAAATTTCACTGAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001782.2-1184s21c1
Sequence:CCGGGCTTTCAGGTTTCCAGATTAGCTCGAGCTAATCTGGAAACCTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001782.2-953s21c1
Sequence:CCGGCAATCACACTCTTACTACTTCCTCGAGGAAGTAGTAAGAGTGTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-1007s1c1
Sequence:CCGGGCCTCAGCTCTAACAAGGATTCTCGAGAATCCTTGTTAGAGCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-372s1c1
Sequence:CCGGCCGCACAACCTGCCTGCGATACTCGAGTATCGCAGGCAGGTTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-1052s1c1
Sequence:CCGGGCACTAGGACTTATGCTCAAACTCGAGTTTGAGCATAAGTCCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-214s1c1
Sequence:CCGGGAAATCACCTACGAGAATGTTCTCGAGAACATTCTCGTAGGTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-1024s1c1
Sequence:CCGGGATTGGAAGTTGACTGATGATCTCGAGATCATCAGTCAACTTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001782
CD72 MISSION shRNA shRNA Plasmid DNA
CD72 molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001782.2-441s21c1
Sequence:CCGGTGTTAGGAGTGACCGCCATCTCTCGAGAGATGGCGGTCACTCCTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001782.2-929s21c1
Sequence:CCGGGCCACATTCAGTGAAATTTATCTCGAGATAAATTTCACTGAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001782.2-1184s21c1
Sequence:CCGGGCTTTCAGGTTTCCAGATTAGCTCGAGCTAATCTGGAAACCTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001782.2-953s21c1
Sequence:CCGGCAATCACACTCTTACTACTTCCTCGAGGAAGTAGTAAGAGTGTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-1007s1c1
Sequence:CCGGGCCTCAGCTCTAACAAGGATTCTCGAGAATCCTTGTTAGAGCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-372s1c1
Sequence:CCGGCCGCACAACCTGCCTGCGATACTCGAGTATCGCAGGCAGGTTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-1052s1c1
Sequence:CCGGGCACTAGGACTTATGCTCAAACTCGAGTTTGAGCATAAGTCCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-214s1c1
Sequence:CCGGGAAATCACCTACGAGAATGTTCTCGAGAACATTCTCGTAGGTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-1024s1c1
Sequence:CCGGGATTGGAAGTTGACTGATGATCTCGAGATCATCAGTCAACTTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001782
CD72 MISSION shRNA Lentiviral Transduction Particles
CD72 molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001782.2-441s21c1
Sequence:CCGGTGTTAGGAGTGACCGCCATCTCTCGAGAGATGGCGGTCACTCCTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001782.2-929s21c1
Sequence:CCGGGCCACATTCAGTGAAATTTATCTCGAGATAAATTTCACTGAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001782.2-1184s21c1
Sequence:CCGGGCTTTCAGGTTTCCAGATTAGCTCGAGCTAATCTGGAAACCTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001782.2-953s21c1
Sequence:CCGGCAATCACACTCTTACTACTTCCTCGAGGAAGTAGTAAGAGTGTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-1007s1c1
Sequence:CCGGGCCTCAGCTCTAACAAGGATTCTCGAGAATCCTTGTTAGAGCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-372s1c1
Sequence:CCGGCCGCACAACCTGCCTGCGATACTCGAGTATCGCAGGCAGGTTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-1052s1c1
Sequence:CCGGGCACTAGGACTTATGCTCAAACTCGAGTTTGAGCATAAGTCCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-214s1c1
Sequence:CCGGGAAATCACCTACGAGAATGTTCTCGAGAACATTCTCGTAGGTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001782.1-1024s1c1
Sequence:CCGGGATTGGAAGTTGACTGATGATCTCGAGATCATCAGTCAACTTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007654
CD72 MISSION shRNA Bacterial Glycerol Stock
CD72 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-971s1c1
Sequence:CCGGGCCGATATTGTGACAAGATAACTCGAGTTATCTTGTCACAATATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-537s1c1
Sequence:CCGGCCAGGACACATTACAGGAGAACTCGAGTTCTCCTGTAATGTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-84s1c1
Sequence:CCGGCCTGAAGAACAGCGCATCTAACTCGAGTTAGATGCGCTGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-733s1c1
Sequence:CCGGCCATGCGGATGGATTCCATATCTCGAGATATGGAATCCATCCGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-846s1c1
Sequence:CCGGCGATGAACCTTCTAAGTATTACTCGAGTAATACTTAGAAGGTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007654
CD72 MISSION shRNA shRNA Plasmid DNA
CD72 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-971s1c1
Sequence:CCGGGCCGATATTGTGACAAGATAACTCGAGTTATCTTGTCACAATATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-537s1c1
Sequence:CCGGCCAGGACACATTACAGGAGAACTCGAGTTCTCCTGTAATGTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-84s1c1
Sequence:CCGGCCTGAAGAACAGCGCATCTAACTCGAGTTAGATGCGCTGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-733s1c1
Sequence:CCGGCCATGCGGATGGATTCCATATCTCGAGATATGGAATCCATCCGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-846s1c1
Sequence:CCGGCGATGAACCTTCTAAGTATTACTCGAGTAATACTTAGAAGGTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007654
CD72 MISSION shRNA Lentiviral Transduction Particles
CD72 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-971s1c1
Sequence:CCGGGCCGATATTGTGACAAGATAACTCGAGTTATCTTGTCACAATATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-537s1c1
Sequence:CCGGCCAGGACACATTACAGGAGAACTCGAGTTCTCCTGTAATGTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-84s1c1
Sequence:CCGGCCTGAAGAACAGCGCATCTAACTCGAGTTAGATGCGCTGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-733s1c1
Sequence:CCGGCCATGCGGATGGATTCCATATCTCGAGATATGGAATCCATCCGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007654.1-846s1c1
Sequence:CCGGCGATGAACCTTCTAAGTATTACTCGAGTAATACTTAGAAGGTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks