EMAIL THIS PAGE TO A FRIEND

CD74

CD74 molecule, major histocompatibility complex, class II invariant chain

101 Gene Product Result for
Synonyms: DHLAG HLADG II Ia-GAMMA
Gene ID:
Human(972) Summary: The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Mouse(16149) CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)
Rat(25599) Cd74 molecule, major histocompatibility complex, class II invariant chain
chicken(414741) CD74 molecule, major histocompatibility complex, class II invariant chain
cow(613384) CD74 molecule, major histocompatibility complex, class II invariant chain
domestic cat(101085953) CD74 molecule, major histocompatibility complex, class II invariant chain
dog(479329) CD74 molecule, major histocompatibility complex, class II invariant chain
sheep(101102561) CD74 molecule, major histocompatibility complex, class II invariant chain
domestic guinea pig(100735496) CD74 molecule, major histocompatibility complex, class II invariant chain
naked mole-rat(101723625) CD74 molecule, major histocompatibility complex, class II invariant chain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1351 Human CD74 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004355 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MABF33 Anti-MHC class II (I-A/I-E) Antibody, clone M5/114 Detect MHC class II (I-A/I-E) using this Anti-MHC class II (I-A/I-E) Antibody, clone M5/114 validated for use in WB, FC, IH. pricing
MABF80C Anti-MHC class II (I-A/I-E), APC, clone M5/114 .15.2 Antibody This rat monoclonal Anti-MHC class II (I-A/I-E) Antibody, APC, clone M5/114 .15.2, Cat. No. MABF805 is validated for use in Flow Cytometry, for the detection of MHC class II (I-A/I-E). pricing
MABF80D Anti-MHC class II (I-A/I-E), FITC, clone M5/114.15.2 Antibody Anti-MHC class II (I-A/I-E), FITC, clone M5/114.15.2 Antibody is an antibody against MHC class II for use in Flow Cytometry. pricing
MABF1411 Anti-MHC class II (I-A/I-E), PE, clone M5/114 .15.2 Antibody Anti-MHC class II (I-A/I-E), PE, clone M5/114 .15.2 Antibody is an antibody against MHC class II for use in Flow Cytometry. pricing
MABF810 Anti-MHC class II (I-A/I-E), PE, clone M5/114 .15.2 Antibody Anti-MHC class II (I-A/I-E), PE, clone M5/114 .15.2 Antibody is an antibody against MHC class II for use in Flow Cytometry. pricing
MABF141C Anti-MHC class II (I-A/I-E), redFluor™ 710, clone M5/114 .15.2 Antibody Anti-MHC class II (I-A/I-E), redFluor™ 710, clone M5/114 .15.2 Antibody is an antibody against MHC class II for use in Flow Cytometry. pricing
MABF141B Anti-MHC class II (I-A/I-E), violetFluor™ 450, clone M5/114 .15.2 Antibody Anti-MHC class II (I-A/I-E), violetFluor™ 450, clone M5/114 .15.2 Antibody is an antibody against MHC class II for use in Flow Cytometry. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025158 Rosetta Predictions human pricing
NM_001025159 Rosetta Predictions human pricing
NM_004355 Rosetta Predictions human pricing
NM_013069 Rosetta Predictions rat pricing
NM_001042605 Rosetta Predictions mouse pricing
NM_010545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208013 predicted 688
2 SASI_Hs01_00208014 predicted 691
3 SASI_Hs01_00208015 predicted 821
4 SASI_Hs02_00307379 predicted 870
5 SASI_Hs01_00208016 predicted 832
6 SASI_Hs01_00208017 predicted 730
7 SASI_Hs02_00307380 predicted 861
8 SASI_Hs01_00208018 predicted 220
9 SASI_Hs02_00307381 predicted 798
10 SASI_Hs01_00208019 predicted 690
11 SASI_Hs01_00208020 predicted 813
12 SASI_Hs01_00208021 predicted 674
13 SASI_Hs01_00208022 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067485 predicted 1056
2 SASI_Hs01_00067486 predicted 1058
3 SASI_Hs01_00067487 predicted 1191
4 SASI_Hs02_00307382 predicted 1242
5 SASI_Hs01_00067488 predicted 1200
6 SASI_Hs01_00067489 predicted 1093
7 SASI_Hs02_00307383 predicted 1230
8 SASI_Hs01_00067490 predicted 210
9 SASI_Hs02_00307384 predicted 1165
10 SASI_Hs01_00067491 predicted 1055
11 SASI_Hs01_00067492 predicted 1186
12 SASI_Hs01_00067493 predicted 1040
13 SASI_Hs01_00067494 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142175 predicted 866
2 SASI_Hs01_00142176 predicted 864
3 SASI_Hs01_00142177 predicted 1001
4 SASI_Hs02_00337420 predicted 1048
5 SASI_Hs01_00142178 predicted 1012
6 SASI_Hs01_00142179 predicted 899
7 SASI_Hs02_00337421 predicted 1042
8 SASI_Hs01_00142180 predicted 213
9 SASI_Hs02_00337422 predicted 973
10 SASI_Hs01_00142181 predicted 860
11 SASI_Hs01_00142182 predicted 991
12 SASI_Hs01_00142183 predicted 847
13 SASI_Hs01_00142184 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099379 predicted 590
2 SASI_Rn01_00099380 predicted 540
3 SASI_Rn01_00099381 predicted 602
4 SASI_Rn01_00099382 predicted 675
5 SASI_Rn01_00099383 predicted 467
6 SASI_Rn01_00099384 predicted 423
7 SASI_Rn01_00099385 predicted 780
8 SASI_Rn01_00099386 predicted 662
9 SASI_Rn02_00260817 predicted 713
10 SASI_Rn01_00099387 predicted 466
11 SASI_Rn01_00099388 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290685 predicted 313
2 SASI_Mm02_00290686 predicted 375
3 SASI_Mm02_00290687 predicted 405
4 SASI_Mm02_00290688 predicted 261
5 SASI_Mm02_00290689 predicted 345
6 SASI_Mm02_00290690 predicted 360
7 SASI_Mm02_00290691 predicted 308
8 SASI_Mm02_00290692 predicted 332
9 SASI_Mm02_00290693 predicted 319
10 SASI_Mm02_00290694 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107918 predicted 310
2 SASI_Mm01_00107920 predicted 378
3 SASI_Mm01_00107921 predicted 413
4 SASI_Mm01_00107923 predicted 254
5 SASI_Mm02_00318795 predicted 345
6 SASI_Mm02_00318796 predicted 361
7 SASI_Mm02_00318797 predicted 311
8 SASI_Mm02_00318798 predicted 341
9 SASI_Mm02_00318799 predicted 318
10 SASI_Mm02_00318800 predicted 428
11 SASI_Mm01_00107919 predicted 1001
12 SASI_Mm01_00107922 predicted 991
13 SASI_Mm01_00107924 predicted 892
14 SASI_Mm01_00107925 predicted 979
15 SASI_Mm01_00107926 predicted 859
16 SASI_Mm01_00107927 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004355
CD74 MISSION shRNA Bacterial Glycerol Stock
CD74 molecule, major histocompatibility complex, class II invariant chain
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004355.1-742s1c1
Sequence:CCGGCCACACAGCTACAGCTTTCTTCTCGAGAAGAAAGCTGTAGCTGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004355.1-529s1c1
Sequence:CCGGGACCATAGACTGGAAGGTCTTCTCGAGAAGACCTTCCAGTCTATGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004355.1-399s1c1
Sequence:CCGGCCACCAAGTATGGCAACATGACTCGAGTCATGTTGCCATACTTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004355.1-68s1c1
Sequence:CCGGCGCGACCTTATCTCCAACAATCTCGAGATTGTTGGAGATAAGGTCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004355.1-623s1c1
Sequence:CCGGCCACCGAAAGAGTCACTGGAACTCGAGTTCCAGTGACTCTTTCGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004355.2-501s21c1
Sequence:CCGGGAGAACCTGAGACACCTTAAGCTCGAGCTTAAGGTGTCTCAGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004355.2-867s21c1
Sequence:CCGGCAAGTCGGAACAGCAGATAACCTCGAGGTTATCTGCTGTTCCGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004355.2-1014s21c1
Sequence:CCGGACCTAGGCTCATGGACGAGATCTCGAGATCTCGTCCATGAGCCTAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004355
CD74 MISSION shRNA shRNA Plasmid DNA
CD74 molecule, major histocompatibility complex, class II invariant chain
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004355.1-742s1c1
Sequence:CCGGCCACACAGCTACAGCTTTCTTCTCGAGAAGAAAGCTGTAGCTGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004355.1-529s1c1
Sequence:CCGGGACCATAGACTGGAAGGTCTTCTCGAGAAGACCTTCCAGTCTATGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004355.1-399s1c1
Sequence:CCGGCCACCAAGTATGGCAACATGACTCGAGTCATGTTGCCATACTTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004355.1-68s1c1
Sequence:CCGGCGCGACCTTATCTCCAACAATCTCGAGATTGTTGGAGATAAGGTCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004355.1-623s1c1
Sequence:CCGGCCACCGAAAGAGTCACTGGAACTCGAGTTCCAGTGACTCTTTCGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004355.2-501s21c1
Sequence:CCGGGAGAACCTGAGACACCTTAAGCTCGAGCTTAAGGTGTCTCAGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004355.2-867s21c1
Sequence:CCGGCAAGTCGGAACAGCAGATAACCTCGAGGTTATCTGCTGTTCCGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004355.2-1014s21c1
Sequence:CCGGACCTAGGCTCATGGACGAGATCTCGAGATCTCGTCCATGAGCCTAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004355
CD74 MISSION shRNA Lentiviral Transduction Particles
CD74 molecule, major histocompatibility complex, class II invariant chain
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004355.1-742s1c1
Sequence:CCGGCCACACAGCTACAGCTTTCTTCTCGAGAAGAAAGCTGTAGCTGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004355.1-529s1c1
Sequence:CCGGGACCATAGACTGGAAGGTCTTCTCGAGAAGACCTTCCAGTCTATGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004355.1-399s1c1
Sequence:CCGGCCACCAAGTATGGCAACATGACTCGAGTCATGTTGCCATACTTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004355.1-68s1c1
Sequence:CCGGCGCGACCTTATCTCCAACAATCTCGAGATTGTTGGAGATAAGGTCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004355.1-623s1c1
Sequence:CCGGCCACCGAAAGAGTCACTGGAACTCGAGTTCCAGTGACTCTTTCGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004355.2-501s21c1
Sequence:CCGGGAGAACCTGAGACACCTTAAGCTCGAGCTTAAGGTGTCTCAGGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004355.2-867s21c1
Sequence:CCGGCAAGTCGGAACAGCAGATAACCTCGAGGTTATCTGCTGTTCCGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004355.2-1014s21c1
Sequence:CCGGACCTAGGCTCATGGACGAGATCTCGAGATCTCGTCCATGAGCCTAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010545
CD74 MISSION shRNA Bacterial Glycerol Stock
CD74 molecule, major histocompatibility complex, class II invariant chain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-718s1c1
Sequence:CCGGGCGTCCAATGTCCATGGATAACTCGAGTTATCCATGGACATTGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-763s1c1
Sequence:CCGGCGTTACCAAGTACGGCAACATCTCGAGATGTTGCCGTACTTGGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-650s1c1
Sequence:CCGGCTTCGCATGAAGCTTCCGAAACTCGAGTTTCGGAAGCTTCATGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-575s1c1
Sequence:CCGGGCTTACTTCCTGTACCAGCAACTCGAGTTGCTGGTACAGGAAGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-934s1c1
Sequence:CCGGGCTCTTGTTTGAGATGAGCAACTCGAGTTGCTCATCTCAAACAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010545
CD74 MISSION shRNA shRNA Plasmid DNA
CD74 molecule, major histocompatibility complex, class II invariant chain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-718s1c1
Sequence:CCGGGCGTCCAATGTCCATGGATAACTCGAGTTATCCATGGACATTGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-763s1c1
Sequence:CCGGCGTTACCAAGTACGGCAACATCTCGAGATGTTGCCGTACTTGGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-650s1c1
Sequence:CCGGCTTCGCATGAAGCTTCCGAAACTCGAGTTTCGGAAGCTTCATGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-575s1c1
Sequence:CCGGGCTTACTTCCTGTACCAGCAACTCGAGTTGCTGGTACAGGAAGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-934s1c1
Sequence:CCGGGCTCTTGTTTGAGATGAGCAACTCGAGTTGCTCATCTCAAACAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010545
CD74 MISSION shRNA Lentiviral Transduction Particles
CD74 molecule, major histocompatibility complex, class II invariant chain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-718s1c1
Sequence:CCGGGCGTCCAATGTCCATGGATAACTCGAGTTATCCATGGACATTGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-763s1c1
Sequence:CCGGCGTTACCAAGTACGGCAACATCTCGAGATGTTGCCGTACTTGGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-650s1c1
Sequence:CCGGCTTCGCATGAAGCTTCCGAAACTCGAGTTTCGGAAGCTTCATGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-575s1c1
Sequence:CCGGGCTTACTTCCTGTACCAGCAACTCGAGTTGCTGGTACAGGAAGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010545.2-934s1c1
Sequence:CCGGGCTCTTGTTTGAGATGAGCAACTCGAGTTGCTCATCTCAAACAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)