EMAIL THIS PAGE TO A FRIEND

CD79A

CD79a molecule, immunoglobulin-associated alpha

64 Gene Product Result for
Synonyms: IGA MB-1
UniProtKB ID: P11912, A0N775, Q53FB8
Gene ID:
Human(973) Summary: The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-alpha protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(12518) CD79A antigen (immunoglobulin-associated alpha)
Rat(681236) Cd79a molecule, immunoglobulin-associated alpha
Zebrafish(798792) CD79a molecule, immunoglobulin-associated alpha
dog(484483) CD79a molecule, immunoglobulin-associated alpha
domestic cat(101083127) CD79a molecule, immunoglobulin-associated alpha
cow(281674) CD79a molecule, immunoglobulin-associated alpha
Horse(100052219) CD79a molecule, immunoglobulin-associated alpha
naked mole-rat(101725058) CD79a molecule, immunoglobulin-associated alpha
domestic guinea pig(100724815) CD79a molecule, immunoglobulin-associated alpha
sheep(101105681) CD79a molecule, immunoglobulin-associated alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0636 Human CD79A ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001783 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001783 Rosetta Predictions human pricing
NM_021601 Rosetta Predictions human pricing
XM_001060872 Rosetta Predictions rat pricing
NM_007655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178755 predicted 990
2 SASI_Hs01_00178756 predicted 821
3 SASI_Hs01_00178757 predicted 902
4 SASI_Hs01_00178758 predicted 920
5 SASI_Hs01_00178759 predicted 832
6 SASI_Hs01_00178760 predicted 909
7 SASI_Hs02_00332542 predicted 936
8 SASI_Hs01_00178761 predicted 809
9 SASI_Hs01_00178763 predicted 207
10 SASI_Hs02_00332543 predicted 817
11 SASI_Hs01_00178762 predicted 901
12 SASI_Hs01_00178764 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071033 predicted 876
2 SASI_Hs01_00071034 predicted 706
3 SASI_Hs01_00071035 predicted 786
4 SASI_Hs01_00071036 predicted 802
5 SASI_Hs01_00071037 predicted 714
6 SASI_Hs01_00071038 predicted 797
7 SASI_Hs02_00354945 predicted 822
8 SASI_Hs01_00071039 predicted 700
9 SASI_Hs01_00071041 predicted 207
10 SASI_Hs02_00354946 predicted 702
11 SASI_Hs01_00071040 predicted 788
12 SASI_Hs01_00071042 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060872 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297994 predicted 546
2 SASI_Rn02_00297995 predicted 510
3 SASI_Rn02_00297996 predicted 290
4 SASI_Rn02_00297997 predicted 497
5 SASI_Rn02_00297998 predicted 415
6 SASI_Rn02_00297999 predicted 537
7 SASI_Rn02_00298000 predicted 547
8 SASI_Rn02_00298001 predicted 629
9 SASI_Rn02_00298002 predicted 497
10 SASI_Rn02_00298003 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198368 predicted 301
2 SASI_Mm01_00198369 predicted 564
3 SASI_Mm01_00198370 predicted 515
4 SASI_Mm01_00198371 predicted 517
5 SASI_Mm01_00198372 predicted 436
6 SASI_Mm01_00198373 predicted 807
7 SASI_Mm02_00312151 predicted 562
8 SASI_Mm01_00198374 predicted 900
9 SASI_Mm01_00198375 predicted 611
10 SASI_Mm01_00198377 predicted 854
11 SASI_Mm01_00198376 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001783
CD79A MISSION shRNA Bacterial Glycerol Stock
CD79a molecule, immunoglobulin-associated alpha
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001783.3-599s21c1
Sequence:CCGGGGGCACCAAGAACCGAATCATCTCGAGATGATTCGGTTCTTGGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001783.3-963s21c1
Sequence:CCGGGGGCTTCCTTAGTCATATTCCCTCGAGGGAATATGACTAAGGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-623s1c1
Sequence:CCGGGCTCCATGTATGAGGACATCTCTCGAGAGATGTCCTCATACATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-188s1c1
Sequence:CCGGACTTCCAATGCCCGCACAATACTCGAGTATTGTGCGGGCATTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-521s1c1
Sequence:CCGGTGCTGCTGTTCAGGAAACGATCTCGAGATCGTTTCCTGAACAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-681s1c1
Sequence:CCGGCCTCAACATAGGAGATGTCCACTCGAGTGGACATCTCCTATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-204s1c1
Sequence:CCGGCAATAGCAGCAACAACGCCAACTCGAGTTGGCGTTGTTGCTGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001783
CD79A MISSION shRNA shRNA Plasmid DNA
CD79a molecule, immunoglobulin-associated alpha
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001783.3-599s21c1
Sequence:CCGGGGGCACCAAGAACCGAATCATCTCGAGATGATTCGGTTCTTGGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001783.3-963s21c1
Sequence:CCGGGGGCTTCCTTAGTCATATTCCCTCGAGGGAATATGACTAAGGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-623s1c1
Sequence:CCGGGCTCCATGTATGAGGACATCTCTCGAGAGATGTCCTCATACATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-188s1c1
Sequence:CCGGACTTCCAATGCCCGCACAATACTCGAGTATTGTGCGGGCATTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-521s1c1
Sequence:CCGGTGCTGCTGTTCAGGAAACGATCTCGAGATCGTTTCCTGAACAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-681s1c1
Sequence:CCGGCCTCAACATAGGAGATGTCCACTCGAGTGGACATCTCCTATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-204s1c1
Sequence:CCGGCAATAGCAGCAACAACGCCAACTCGAGTTGGCGTTGTTGCTGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001783
CD79A MISSION shRNA Lentiviral Transduction Particles
CD79a molecule, immunoglobulin-associated alpha
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001783.3-599s21c1
Sequence:CCGGGGGCACCAAGAACCGAATCATCTCGAGATGATTCGGTTCTTGGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001783.3-963s21c1
Sequence:CCGGGGGCTTCCTTAGTCATATTCCCTCGAGGGAATATGACTAAGGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-623s1c1
Sequence:CCGGGCTCCATGTATGAGGACATCTCTCGAGAGATGTCCTCATACATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-188s1c1
Sequence:CCGGACTTCCAATGCCCGCACAATACTCGAGTATTGTGCGGGCATTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-521s1c1
Sequence:CCGGTGCTGCTGTTCAGGAAACGATCTCGAGATCGTTTCCTGAACAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-681s1c1
Sequence:CCGGCCTCAACATAGGAGATGTCCACTCGAGTGGACATCTCCTATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001783.1-204s1c1
Sequence:CCGGCAATAGCAGCAACAACGCCAACTCGAGTTGGCGTTGTTGCTGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007655
CD79A MISSION shRNA Bacterial Glycerol Stock
CD79a molecule, immunoglobulin-associated alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-481s1c1
Sequence:CCGGCTATTCAGGAAACGGTGGCAACTCGAGTTGCCACCGTTTCCTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-560s1c1
Sequence:CCGGGCCTGAACCTTGATGACTGTTCTCGAGAACAGTCATCAAGGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-177s1c1
Sequence:CCGGCCCTAATATCACATGGTGGTTCTCGAGAACCACCATGTGATATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-54s1c1
Sequence:CCGGCTTCTTGTCATACGCCTGTTTCTCGAGAAACAGGCGTATGACAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-200s1c1
Sequence:CCGGGCCTTCAGTCTAACATCACATCTCGAGATGTGATGTTAGACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007655
CD79A MISSION shRNA shRNA Plasmid DNA
CD79a molecule, immunoglobulin-associated alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-481s1c1
Sequence:CCGGCTATTCAGGAAACGGTGGCAACTCGAGTTGCCACCGTTTCCTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-560s1c1
Sequence:CCGGGCCTGAACCTTGATGACTGTTCTCGAGAACAGTCATCAAGGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-177s1c1
Sequence:CCGGCCCTAATATCACATGGTGGTTCTCGAGAACCACCATGTGATATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-54s1c1
Sequence:CCGGCTTCTTGTCATACGCCTGTTTCTCGAGAAACAGGCGTATGACAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-200s1c1
Sequence:CCGGGCCTTCAGTCTAACATCACATCTCGAGATGTGATGTTAGACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007655
CD79A MISSION shRNA Lentiviral Transduction Particles
CD79a molecule, immunoglobulin-associated alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-481s1c1
Sequence:CCGGCTATTCAGGAAACGGTGGCAACTCGAGTTGCCACCGTTTCCTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-560s1c1
Sequence:CCGGGCCTGAACCTTGATGACTGTTCTCGAGAACAGTCATCAAGGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-177s1c1
Sequence:CCGGCCCTAATATCACATGGTGGTTCTCGAGAACCACCATGTGATATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-54s1c1
Sequence:CCGGCTTCTTGTCATACGCCTGTTTCTCGAGAAACAGGCGTATGACAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007655.1-200s1c1
Sequence:CCGGGCCTTCAGTCTAACATCACATCTCGAGATGTGATGTTAGACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks