EMAIL THIS PAGE TO A FRIEND

CD79B

CD79b molecule, immunoglobulin-associated beta

Synonyms: AGM6 B29 IGB
UniProtKB ID: P40259, Q53FS2, Q9BU06
Gene ID:
Human(974) Summary: The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(15985) CD79B antigen
Rat(171055) Cd79b molecule, immunoglobulin-associated beta
sheep(101104586) CD79b molecule, immunoglobulin-associated beta
domestic guinea pig(100718014) CD79b molecule, immunoglobulin-associated beta
naked mole-rat(101712603) CD79b molecule, immunoglobulin-associated beta
chicken(419940) CD79b molecule, immunoglobulin-associated beta
dog(609449) CD79b molecule, immunoglobulin-associated beta
cow(509801) CD79b molecule, immunoglobulin-associated beta
domestic cat(101098098) CD79b molecule, immunoglobulin-associated beta
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000626 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008339 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008339 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008339 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097211 MISSION® esiRNA esiRNA human CD79B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000626 Rosetta Predictions human pricing
NM_001039933 Rosetta Predictions human pricing
NM_021602 Rosetta Predictions human pricing
NM_133533 Rosetta Predictions rat pricing
NM_008339 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146516 predicted 806
2 SASI_Hs01_00146517 predicted 890
3 SASI_Hs01_00146518 predicted 936
4 SASI_Hs01_00146519 predicted 935
5 SASI_Hs01_00146520 predicted 731
6 SASI_Hs01_00146521 predicted 937
7 SASI_Hs01_00146522 predicted 969
8 SASI_Hs01_00146523 predicted 754
9 SASI_Hs01_00146524 predicted 742
10 SASI_Hs02_00302967 predicted 750
11 SASI_Hs01_00146525 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100311 predicted 816
2 SASI_Hs01_00100312 predicted 884
3 SASI_Hs01_00100313 predicted 941
4 SASI_Hs01_00100314 predicted 941
5 SASI_Hs01_00100315 predicted 726
6 SASI_Hs01_00100316 predicted 934
7 SASI_Hs01_00100317 predicted 972
8 SASI_Hs01_00100318 predicted 761
9 SASI_Hs01_00100319 predicted 740
10 SASI_Hs02_00308722 predicted 749
11 SASI_Hs01_00100320 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225985 predicted 498
2 SASI_Hs01_00225986 predicted 576
3 SASI_Hs01_00225987 predicted 629
4 SASI_Hs01_00225988 predicted 622
5 SASI_Hs01_00225989 predicted 410
6 SASI_Hs01_00225990 predicted 622
7 SASI_Hs01_00225991 predicted 652
8 SASI_Hs01_00225992 predicted 442
9 SASI_Hs01_00225993 predicted 423
10 SASI_Hs02_00354947 predicted 435
11 SASI_Hs01_00225994 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114129 predicted 673
2 SASI_Rn01_00114130 predicted 969
3 SASI_Rn01_00114131 predicted 340
4 SASI_Rn01_00114132 predicted 294
5 SASI_Rn01_00114133 predicted 636
6 SASI_Rn02_00267715 predicted 317
7 SASI_Rn01_00114135 predicted 436
8 SASI_Rn01_00114136 predicted 513
9 SASI_Rn01_00114138 predicted 462
10 SASI_Rn02_00267716 predicted 470
11 SASI_Rn01_00114134 predicted 331
12 SASI_Rn01_00114137 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194219 predicted 663
2 SASI_Mm01_00194220 predicted 517
3 SASI_Mm01_00194221 predicted 619
4 SASI_Mm01_00194222 predicted 500
5 SASI_Mm01_00194223 predicted 448
6 SASI_Mm01_00194224 predicted 342
7 SASI_Mm01_00194226 predicted 459
8 SASI_Mm02_00313673 predicted 452
9 SASI_Mm01_00194227 predicted 718
10 SASI_Mm02_00313674 predicted 820
11 SASI_Mm01_00194218 predicted 450
12 SASI_Mm01_00194225 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000626
CD79B MISSION shRNA Bacterial Glycerol Stock
CD79b molecule, immunoglobulin-associated beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-242s1c1
Sequence:CCGGCCACGTTTCATAGCCAGGAAACTCGAGTTTCCTGGCTATGAAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-562s1c1
Sequence:CCGGGCTGAAGGATGGTATCATCATCTCGAGATGATGATACCATCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-704s1c1
Sequence:CCGGACAGCCACCTATGAGGACATACTCGAGTATGTCCTCATAGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-604s1c1
Sequence:CCGGCCTCTTCATCATCGTGCCTATCTCGAGATAGGCACGATGATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-457s1c1
Sequence:CCGGCTGTCAGCAGAAGTGCAACAACTCGAGTTGTTGCACTTCTGCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000626.2-202s21c1
Sequence:CCGGGTAGTGCTTGTTCGCGGATCTCTCGAGAGATCCGCGAACAAGCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000626.2-957s21c1
Sequence:CCGGAGGACAACAGGGCAGCAACTTCTCGAGAAGTTGCTGCCCTGTTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000626.2-371s21c1
Sequence:CCGGGGAAGAGTCCCAGAACGAATCCTCGAGGATTCGTTCTGGGACTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000626.2-647s21c1
Sequence:CCGGTGGCATGGAGGAAGATCACACCTCGAGGTGTGATCTTCCTCCATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000626.2-405s21c1
Sequence:CCGGACCATCCAAGGCATCCGGTTTCTCGAGAAACCGGATGCCTTGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000626
CD79B MISSION shRNA shRNA Plasmid DNA
CD79b molecule, immunoglobulin-associated beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-242s1c1
Sequence:CCGGCCACGTTTCATAGCCAGGAAACTCGAGTTTCCTGGCTATGAAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-562s1c1
Sequence:CCGGGCTGAAGGATGGTATCATCATCTCGAGATGATGATACCATCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-704s1c1
Sequence:CCGGACAGCCACCTATGAGGACATACTCGAGTATGTCCTCATAGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-604s1c1
Sequence:CCGGCCTCTTCATCATCGTGCCTATCTCGAGATAGGCACGATGATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-457s1c1
Sequence:CCGGCTGTCAGCAGAAGTGCAACAACTCGAGTTGTTGCACTTCTGCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000626.2-202s21c1
Sequence:CCGGGTAGTGCTTGTTCGCGGATCTCTCGAGAGATCCGCGAACAAGCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000626.2-957s21c1
Sequence:CCGGAGGACAACAGGGCAGCAACTTCTCGAGAAGTTGCTGCCCTGTTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000626.2-371s21c1
Sequence:CCGGGGAAGAGTCCCAGAACGAATCCTCGAGGATTCGTTCTGGGACTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000626.2-647s21c1
Sequence:CCGGTGGCATGGAGGAAGATCACACCTCGAGGTGTGATCTTCCTCCATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000626.2-405s21c1
Sequence:CCGGACCATCCAAGGCATCCGGTTTCTCGAGAAACCGGATGCCTTGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000626
CD79B MISSION shRNA Lentiviral Transduction Particles
CD79b molecule, immunoglobulin-associated beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-242s1c1
Sequence:CCGGCCACGTTTCATAGCCAGGAAACTCGAGTTTCCTGGCTATGAAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-562s1c1
Sequence:CCGGGCTGAAGGATGGTATCATCATCTCGAGATGATGATACCATCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-704s1c1
Sequence:CCGGACAGCCACCTATGAGGACATACTCGAGTATGTCCTCATAGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-604s1c1
Sequence:CCGGCCTCTTCATCATCGTGCCTATCTCGAGATAGGCACGATGATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000626.1-457s1c1
Sequence:CCGGCTGTCAGCAGAAGTGCAACAACTCGAGTTGTTGCACTTCTGCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000626.2-202s21c1
Sequence:CCGGGTAGTGCTTGTTCGCGGATCTCTCGAGAGATCCGCGAACAAGCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000626.2-957s21c1
Sequence:CCGGAGGACAACAGGGCAGCAACTTCTCGAGAAGTTGCTGCCCTGTTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000626.2-371s21c1
Sequence:CCGGGGAAGAGTCCCAGAACGAATCCTCGAGGATTCGTTCTGGGACTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000626.2-647s21c1
Sequence:CCGGTGGCATGGAGGAAGATCACACCTCGAGGTGTGATCTTCCTCCATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000626.2-405s21c1
Sequence:CCGGACCATCCAAGGCATCCGGTTTCTCGAGAAACCGGATGCCTTGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008339
CD79B MISSION shRNA Bacterial Glycerol Stock
CD79b molecule, immunoglobulin-associated beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-594s1c1
Sequence:CCGGCGGAACTTCTAGTCTTAGGATCTCGAGATCCTAAGACTAGAAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-367s1c1
Sequence:CCGGGAAGTTTCACTGCTACACAAACTCGAGTTTGTGTAGCAGTGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-564s1c1
Sequence:CCGGCCAACCATAATGTCACCGACACTCGAGTGTCGGTGACATTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-484s1c1
Sequence:CCGGCTCTGTCTACACCCTCACTATCTCGAGATAGTGAGGGTGTAGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-795s1c1
Sequence:CCGGCCACCTATGAAGACATAGTGACTCGAGTCACTATGTCTTCATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008339
CD79B MISSION shRNA shRNA Plasmid DNA
CD79b molecule, immunoglobulin-associated beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-594s1c1
Sequence:CCGGCGGAACTTCTAGTCTTAGGATCTCGAGATCCTAAGACTAGAAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-367s1c1
Sequence:CCGGGAAGTTTCACTGCTACACAAACTCGAGTTTGTGTAGCAGTGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-564s1c1
Sequence:CCGGCCAACCATAATGTCACCGACACTCGAGTGTCGGTGACATTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-484s1c1
Sequence:CCGGCTCTGTCTACACCCTCACTATCTCGAGATAGTGAGGGTGTAGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-795s1c1
Sequence:CCGGCCACCTATGAAGACATAGTGACTCGAGTCACTATGTCTTCATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008339
CD79B MISSION shRNA Lentiviral Transduction Particles
CD79b molecule, immunoglobulin-associated beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-594s1c1
Sequence:CCGGCGGAACTTCTAGTCTTAGGATCTCGAGATCCTAAGACTAGAAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-367s1c1
Sequence:CCGGGAAGTTTCACTGCTACACAAACTCGAGTTTGTGTAGCAGTGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-564s1c1
Sequence:CCGGCCAACCATAATGTCACCGACACTCGAGTGTCGGTGACATTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-484s1c1
Sequence:CCGGCTCTGTCTACACCCTCACTATCTCGAGATAGTGAGGGTGTAGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008339.1-795s1c1
Sequence:CCGGCCACCTATGAAGACATAGTGACTCGAGTCACTATGTCTTCATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks