EMAIL THIS PAGE TO A FRIEND

CD80

CD80 molecule

Synonyms: B7 B7-1 B7.1 BB1 CD28LG CD28LG1 LAB7
UniProtKB ID: P33681
Gene ID:
Human(941) Summary: The protein encoded by this gene is a membrane receptor that is activated by the binding of CD28 or CTLA-4. The activated protein induces T-cell proliferation and cytokine production. This protein can act as a receptor for adenovirus subgroup B and may play a role in lupus neuropathy. [provided by RefSeq, Aug 2011]
Mouse(12519) CD80 antigen
Rat(25408) Cd80 molecule
chicken(768950) CD80 molecule
cow(407131) CD80 molecule
domestic cat(493786) CD80 molecule
dog(403765) CD80 molecule
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501656 Anti-CD80 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1405584 Anti-CD80 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA050092 Anti-CD80 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4700559 Monoclonal Anti-Cd80 antibody produced in hamster clone 16-10A1, purified immunoglobulin, buffered aqueous solution mouse, canine
flow cytometry pricing
WH0000941M1 Monoclonal Anti-CD80 antibody produced in mouse clone 1G1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403647 Monoclonal Anti-CD80 antibody produced in mouse clone 3E10, ascites fluid human
ELISA, western blot pricing
SAB4700140 Monoclonal Anti-CD80 antibody produced in mouse clone MEM-233, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700141 Monoclonal Anti-CD80-APC antibody produced in mouse clone MEM-233, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700142 Monoclonal Anti-CD80-FITC antibody produced in mouse clone MEM-233, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700143 Monoclonal Anti-CD80-PE antibody produced in mouse clone MEM-233, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
594687 α-Sexithiophene human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005191 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036201 MISSION® esiRNA esiRNA human CD80 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005191 Rosetta Predictions human pricing
NM_012926 Rosetta Predictions rat pricing
NM_009855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221512 predicted 413
2 SASI_Hs01_00221513 predicted 983
3 SASI_Hs01_00221514 predicted 797
4 SASI_Hs01_00221515 predicted 545
5 SASI_Hs01_00221516 predicted 838
6 SASI_Hs01_00221517 predicted 1052
7 SASI_Hs01_00221519 predicted 1138
8 SASI_Hs01_00221520 predicted 726
9 SASI_Hs01_00221521 predicted 978
10 SASI_Hs02_00339140 predicted 782
11 SASI_Hs01_00221518 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081715 predicted 298
2 SASI_Rn01_00081716 predicted 567
3 SASI_Rn01_00081717 predicted 284
4 SASI_Rn01_00081718 predicted 351
5 SASI_Rn01_00081719 predicted 552
6 SASI_Rn02_00260470 predicted 518
7 SASI_Rn02_00260471 predicted 362
8 SASI_Rn01_00081721 predicted 453
9 SASI_Rn01_00081722 predicted 558
10 SASI_Rn01_00081723 predicted 392
11 SASI_Rn01_00081720 predicted 378
12 SASI_Rn01_00081724 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085285 predicted 788
2 SASI_Mm02_00317244 predicted 257
3 SASI_Mm02_00317245 predicted 793
4 SASI_Mm02_00317246 predicted 328
5 SASI_Mm01_00085290 predicted 513
6 SASI_Mm02_00317247 predicted 815
7 SASI_Mm02_00317248 predicted 391
8 SASI_Mm01_00085291 predicted 687
9 SASI_Mm02_00317249 predicted 410
10 SASI_Mm02_00317250 predicted 861
11 SASI_Mm01_00085282 predicted 949
12 SASI_Mm01_00085283 predicted 380
13 SASI_Mm01_00085284 predicted 586
14 SASI_Mm01_00085286 predicted 341
15 SASI_Mm01_00085287 predicted 964
16 SASI_Mm01_00085288 predicted 242
17 SASI_Mm01_00085289 predicted 368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005191
CD80 MISSION shRNA Bacterial Glycerol Stock
CD80 molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005191.3-1641s21c1
Sequence:CCGGGTGGCCTGTTAACTGGTATATCTCGAGATATACCAGTTAACAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005191.3-784s21c1
Sequence:CCGGACCTGGCTGAAGTGACGTTATCTCGAGATAACGTCACTTCAGCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005191.3-1518s21c1
Sequence:CCGGGAGAATACCAGTGTTATTAATCTCGAGATTAATAACACTGGTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005191.3-666s21c1
Sequence:CCGGACCATCTTTGATATCACTAATCTCGAGATTAGTGATATCAAAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-796s1c1
Sequence:CCGGCCTAGTATATCTGACTTTGAACTCGAGTTCAAAGTCAGATATACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-1112s1c1
Sequence:CCGGCCTTAATCTCAGTAAATGGAACTCGAGTTCCATTTACTGAGATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-450s1c1
Sequence:CCGGTCACTTCTGTTCAGGTGTTATCTCGAGATAACACCTGAACAGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-1012s1c1
Sequence:CCGGCTCATCAAGTATGGACATTTACTCGAGTAAATGTCCATACTTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-965s1c1
Sequence:CCGGGCAGCAAACTGGATTTCAATACTCGAGTATTGAAATCCAGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005191
CD80 MISSION shRNA shRNA Plasmid DNA
CD80 molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005191.3-1641s21c1
Sequence:CCGGGTGGCCTGTTAACTGGTATATCTCGAGATATACCAGTTAACAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005191.3-784s21c1
Sequence:CCGGACCTGGCTGAAGTGACGTTATCTCGAGATAACGTCACTTCAGCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005191.3-1518s21c1
Sequence:CCGGGAGAATACCAGTGTTATTAATCTCGAGATTAATAACACTGGTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005191.3-666s21c1
Sequence:CCGGACCATCTTTGATATCACTAATCTCGAGATTAGTGATATCAAAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-796s1c1
Sequence:CCGGCCTAGTATATCTGACTTTGAACTCGAGTTCAAAGTCAGATATACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-1112s1c1
Sequence:CCGGCCTTAATCTCAGTAAATGGAACTCGAGTTCCATTTACTGAGATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-450s1c1
Sequence:CCGGTCACTTCTGTTCAGGTGTTATCTCGAGATAACACCTGAACAGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-1012s1c1
Sequence:CCGGCTCATCAAGTATGGACATTTACTCGAGTAAATGTCCATACTTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-965s1c1
Sequence:CCGGGCAGCAAACTGGATTTCAATACTCGAGTATTGAAATCCAGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005191
CD80 MISSION shRNA Lentiviral Transduction Particles
CD80 molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005191.3-1641s21c1
Sequence:CCGGGTGGCCTGTTAACTGGTATATCTCGAGATATACCAGTTAACAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005191.3-784s21c1
Sequence:CCGGACCTGGCTGAAGTGACGTTATCTCGAGATAACGTCACTTCAGCCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005191.3-1518s21c1
Sequence:CCGGGAGAATACCAGTGTTATTAATCTCGAGATTAATAACACTGGTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005191.3-666s21c1
Sequence:CCGGACCATCTTTGATATCACTAATCTCGAGATTAGTGATATCAAAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-796s1c1
Sequence:CCGGCCTAGTATATCTGACTTTGAACTCGAGTTCAAAGTCAGATATACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-1112s1c1
Sequence:CCGGCCTTAATCTCAGTAAATGGAACTCGAGTTCCATTTACTGAGATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-450s1c1
Sequence:CCGGTCACTTCTGTTCAGGTGTTATCTCGAGATAACACCTGAACAGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-1012s1c1
Sequence:CCGGCTCATCAAGTATGGACATTTACTCGAGTAAATGTCCATACTTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005191.2-965s1c1
Sequence:CCGGGCAGCAAACTGGATTTCAATACTCGAGTATTGAAATCCAGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009855
CD80 MISSION shRNA Bacterial Glycerol Stock
CD80 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-556s1c1
Sequence:CCGGCCTGGCATCAATACGACAATTCTCGAGAATTGTCGTATTGATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-443s1c1
Sequence:CCGGCCAACATAACTGAGTCTGGAACTCGAGTTCCAGACTCAGTTATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-131s1c1
Sequence:CCGGAGTCAGTGAAAGATAAGGTATCTCGAGATACCTTATCTTTCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-792s1c1
Sequence:CCGGCGTTGTCATCATCAAATGCTTCTCGAGAAGCATTTGATGATGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-266s1c1
Sequence:CCGGCCGAGTATAAGAACCGGACTTCTCGAGAAGTCCGGTTCTTATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009855
CD80 MISSION shRNA shRNA Plasmid DNA
CD80 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-556s1c1
Sequence:CCGGCCTGGCATCAATACGACAATTCTCGAGAATTGTCGTATTGATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-443s1c1
Sequence:CCGGCCAACATAACTGAGTCTGGAACTCGAGTTCCAGACTCAGTTATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-131s1c1
Sequence:CCGGAGTCAGTGAAAGATAAGGTATCTCGAGATACCTTATCTTTCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-792s1c1
Sequence:CCGGCGTTGTCATCATCAAATGCTTCTCGAGAAGCATTTGATGATGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-266s1c1
Sequence:CCGGCCGAGTATAAGAACCGGACTTCTCGAGAAGTCCGGTTCTTATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009855
CD80 MISSION shRNA Lentiviral Transduction Particles
CD80 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-556s1c1
Sequence:CCGGCCTGGCATCAATACGACAATTCTCGAGAATTGTCGTATTGATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-443s1c1
Sequence:CCGGCCAACATAACTGAGTCTGGAACTCGAGTTCCAGACTCAGTTATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-131s1c1
Sequence:CCGGAGTCAGTGAAAGATAAGGTATCTCGAGATACCTTATCTTTCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-792s1c1
Sequence:CCGGCGTTGTCATCATCAAATGCTTCTCGAGAAGCATTTGATGATGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009855.1-266s1c1
Sequence:CCGGCCGAGTATAAGAACCGGACTTCTCGAGAAGTCCGGTTCTTATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks