EMAIL THIS PAGE TO A FRIEND

CD81

CD81 molecule

90 Gene Product Result for
Synonyms: CVID6 S5.7 TAPA1 TSPAN28
UniProtKB ID: P60033, P18582, Q5U0J6
Gene ID:
Human(975) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This protein appears to promote muscle cell fusion and support myotube maintenance. Also it may be involved in signal transduction. This gene is localized in the tumor-suppressor gene region and thus it is a candidate gene for malignancies. [provided by RefSeq, Jul 2008]
Mouse(12520) CD81 antigen
Rat(25621) Cd81 molecule
Zebrafish(58031) CD81 antigen
cow(511435) CD81 molecule
dog(611606) CD81 molecule
chicken(374256) CD81 molecule
Goat(100860811) CD81 molecule
sheep(100147790) CD81 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004356 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031671 MISSION® esiRNA esiRNA human CD81 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004356 Rosetta Predictions human pricing
NM_013087 Rosetta Predictions rat pricing
XM_579369 Rosetta Predictions rat pricing
NM_133655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181702 predicted 869
2 SASI_Hs01_00181703 predicted 1020
3 SASI_Hs01_00181704 predicted 591
4 SASI_Hs01_00181705 predicted 1252
5 SASI_Hs01_00181706 predicted 809
6 SASI_Hs01_00181707 predicted 1088
7 SASI_Hs01_00181708 predicted 1006
8 SASI_Hs01_00181709 predicted 1038
9 SASI_Hs01_00181710 predicted 667
10 SASI_Hs01_00181711 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066147 predicted 743
2 SASI_Rn01_00066149 predicted 667
3 SASI_Rn02_00260854 predicted 340
4 SASI_Rn01_00066150 predicted 677
5 SASI_Rn01_00066151 predicted 314
6 SASI_Rn01_00066152 predicted 238
7 SASI_Rn01_00066153 predicted 493
8 SASI_Rn01_00066154 predicted 609
9 SASI_Rn01_00066155 predicted 861
10 SASI_Rn01_00066156 predicted 320
11 SASI_Rn01_00066148 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00157366 predicted 739
2 SASI_Rn01_00157367 predicted 662
3 SASI_Rn01_00157368 predicted 232
4 SASI_Rn01_00157369 predicted 669
5 SASI_Rn01_00157370 predicted 487
6 SASI_Rn01_00157371 predicted 308
7 SASI_Rn01_00157372 predicted 600
8 SASI_Rn01_00157373 predicted 857
9 SASI_Rn01_00157374 predicted 693
10 SASI_Rn01_00157375 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074400 predicted 769
2 SASI_Mm01_00074401 predicted 609
3 SASI_Mm01_00074402 predicted 726
4 SASI_Mm01_00074403 predicted 267
5 SASI_Mm01_00074404 predicted 665
6 SASI_Mm02_00338587 predicted 742
7 SASI_Mm01_00074405 predicted 456
8 SASI_Mm01_00074406 predicted 805
9 SASI_Mm01_00074407 predicted 540
10 SASI_Mm01_00074409 predicted 796
11 SASI_Mm01_00074408 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004356
VALIDATED
CD81 MISSION shRNA Bacterial Glycerol Stock
CD81 molecule
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004356.2-205s1c1
Sequence:CCGGCAACACCTTCTATGTAGGCATCTCGAGATGCCTACATAGAAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004356.2-577s1c1
Sequence:CCGGCAACATCATCAGCAACCTCTTCTCGAGAAGAGGTTGCTGATGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004356.2-400s1c1
Sequence:CCGGCAAGGATGTGAAGCAGTTCTACTCGAGTAGAACTGCTTCACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004356.2-682s1c1
Sequence:CCGGGATCATGATCTTCGAGATGATCTCGAGATCATCTCGAAGATCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004356.2-76s1c1
Sequence:CCGGCCTGCTCTTCGTCTTCAATTTCTCGAGAAATTGAAGACGAAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-1429s21c1
Sequence:GTACCGGACATCCTGACTCCGTCATTTACTCGAGTAAATGACGGAGTCAGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-1128s21c1
Sequence:GTACCGGCACATGTAGGTGGCGTGTATGCTCGAGCATACACGCCACCTACATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-269s21c1
Sequence:CCGGCCTGCTCTTCGTCTTCAATTTCTCGAGAAATTGAAGACGAAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-875s21c1
Sequence:CCGGGATCATGATCTTCGAGATGATCTCGAGATCATCTCGAAGATCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-398s21c1
Sequence:CCGGCAACACCTTCTATGTAGGCATCTCGAGATGCCTACATAGAAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004356.3-770s21c1
Sequence:CCGGCAACATCATCAGCAACCTCTTCTCGAGAAGAGGTTGCTGATGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004356
VALIDATED
CD81 MISSION shRNA shRNA Plasmid DNA
CD81 molecule
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004356.2-205s1c1
Sequence:CCGGCAACACCTTCTATGTAGGCATCTCGAGATGCCTACATAGAAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004356.2-577s1c1
Sequence:CCGGCAACATCATCAGCAACCTCTTCTCGAGAAGAGGTTGCTGATGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004356.2-400s1c1
Sequence:CCGGCAAGGATGTGAAGCAGTTCTACTCGAGTAGAACTGCTTCACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004356.2-682s1c1
Sequence:CCGGGATCATGATCTTCGAGATGATCTCGAGATCATCTCGAAGATCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004356.2-76s1c1
Sequence:CCGGCCTGCTCTTCGTCTTCAATTTCTCGAGAAATTGAAGACGAAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-1429s21c1
Sequence:GTACCGGACATCCTGACTCCGTCATTTACTCGAGTAAATGACGGAGTCAGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-1128s21c1
Sequence:GTACCGGCACATGTAGGTGGCGTGTATGCTCGAGCATACACGCCACCTACATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-269s21c1
Sequence:CCGGCCTGCTCTTCGTCTTCAATTTCTCGAGAAATTGAAGACGAAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-875s21c1
Sequence:CCGGGATCATGATCTTCGAGATGATCTCGAGATCATCTCGAAGATCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-398s21c1
Sequence:CCGGCAACACCTTCTATGTAGGCATCTCGAGATGCCTACATAGAAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004356.3-770s21c1
Sequence:CCGGCAACATCATCAGCAACCTCTTCTCGAGAAGAGGTTGCTGATGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004356
VALIDATED
CD81 MISSION shRNA Lentiviral Transduction Particles
CD81 molecule
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004356.2-205s1c1
Sequence:CCGGCAACACCTTCTATGTAGGCATCTCGAGATGCCTACATAGAAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004356.2-577s1c1
Sequence:CCGGCAACATCATCAGCAACCTCTTCTCGAGAAGAGGTTGCTGATGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004356.2-400s1c1
Sequence:CCGGCAAGGATGTGAAGCAGTTCTACTCGAGTAGAACTGCTTCACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004356.2-682s1c1
Sequence:CCGGGATCATGATCTTCGAGATGATCTCGAGATCATCTCGAAGATCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004356.2-76s1c1
Sequence:CCGGCCTGCTCTTCGTCTTCAATTTCTCGAGAAATTGAAGACGAAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-1429s21c1
Sequence:GTACCGGACATCCTGACTCCGTCATTTACTCGAGTAAATGACGGAGTCAGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-1128s21c1
Sequence:GTACCGGCACATGTAGGTGGCGTGTATGCTCGAGCATACACGCCACCTACATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-269s21c1
Sequence:CCGGCCTGCTCTTCGTCTTCAATTTCTCGAGAAATTGAAGACGAAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-875s21c1
Sequence:CCGGGATCATGATCTTCGAGATGATCTCGAGATCATCTCGAAGATCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004356.3-398s21c1
Sequence:CCGGCAACACCTTCTATGTAGGCATCTCGAGATGCCTACATAGAAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004356.3-770s21c1
Sequence:CCGGCAACATCATCAGCAACCTCTTCTCGAGAAGAGGTTGCTGATGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133655
VALIDATED
CD81 MISSION shRNA Bacterial Glycerol Stock
CD81 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133655.1-831s1c1
Sequence:CCGGGCCATTGTGGTAGCTGTCATTCTCGAGAATGACAGCTACCACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133655.1-639s1c1
Sequence:CCGGGCTGTGGTGAAGACTTTCCATCTCGAGATGGAAAGTCTTCACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133655.1-408s1c1
Sequence:CCGGGTGGGAGCTGTGATGATGTTTCTCGAGAAACATCATCACAGCTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133655.1-815s1c1
Sequence:CCGGCCTCATTGGAATTGCAGCCATCTCGAGATGGCTGCAATTCCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133655.1-764s1c1
Sequence:CCGGGCAGCAAGATTGTCATCAGAACTCGAGTTCTGATGACAATCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133655
VALIDATED
CD81 MISSION shRNA shRNA Plasmid DNA
CD81 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133655.1-831s1c1
Sequence:CCGGGCCATTGTGGTAGCTGTCATTCTCGAGAATGACAGCTACCACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133655.1-639s1c1
Sequence:CCGGGCTGTGGTGAAGACTTTCCATCTCGAGATGGAAAGTCTTCACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133655.1-408s1c1
Sequence:CCGGGTGGGAGCTGTGATGATGTTTCTCGAGAAACATCATCACAGCTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133655.1-815s1c1
Sequence:CCGGCCTCATTGGAATTGCAGCCATCTCGAGATGGCTGCAATTCCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133655.1-764s1c1
Sequence:CCGGGCAGCAAGATTGTCATCAGAACTCGAGTTCTGATGACAATCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133655
VALIDATED
CD81 MISSION shRNA Lentiviral Transduction Particles
CD81 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133655.1-831s1c1
Sequence:CCGGGCCATTGTGGTAGCTGTCATTCTCGAGAATGACAGCTACCACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133655.1-639s1c1
Sequence:CCGGGCTGTGGTGAAGACTTTCCATCTCGAGATGGAAAGTCTTCACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133655.1-408s1c1
Sequence:CCGGGTGGGAGCTGTGATGATGTTTCTCGAGAAACATCATCACAGCTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133655.1-815s1c1
Sequence:CCGGCCTCATTGGAATTGCAGCCATCTCGAGATGGCTGCAATTCCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133655.1-764s1c1
Sequence:CCGGGCAGCAAGATTGTCATCAGAACTCGAGTTCTGATGACAATCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks