EMAIL THIS PAGE TO A FRIEND

CD82

CD82 molecule

80 Gene Product Result for
Synonyms: 4F9 C33 GR15 IA4 KAI1 R2 SAR2 ST6 TSPAN27
UniProtKB ID: P27701, D3DQN6, E9PC70, Q7Z2D4, Q7Z5N2
Gene ID:
Human(3732) Summary: This metastasis suppressor gene product is a membrane glycoprotein that is a member of the transmembrane 4 superfamily. Expression of this gene has been shown to be downregulated in tumor progression of human cancers and can be activated by p53 through a consensus binding sequence in the promoter. Its expression and that of p53 are strongly correlated, and the loss of expression of these two proteins is associated with poor survival for prostate cancer patients. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12521) CD82 antigen
Rat(83628) Cd82 molecule
sheep(101111121) CD82 molecule
chicken(423172) CD82 molecule
cow(506713) CD82 molecule
domestic cat(101084137) CD82 molecule
dog(611384) CD82 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002231 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024844 Rosetta Predictions human pricing
NM_002231 siRNAs that have been validated in the lab human pricing
NM_031797 Rosetta Predictions rat pricing
NM_007656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092667 predicted 259
2 SASI_Hs01_00092668 predicted 261
3 SASI_Hs01_00092669 predicted 253
4 SASI_Hs01_00092670 predicted 726
5 SASI_Hs01_00092671 predicted 257
6 SASI_Hs01_00092672 predicted 786
7 SASI_Hs01_00092673 predicted 1079
8 SASI_Hs01_00092674 predicted 265
9 SASI_Hs01_00092675 predicted 1072
10 SASI_Hs01_00092676 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002231 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214423 validated 858
1 SASI_Hs01_00214418 validated 252
2 SASI_Hs01_00214419 predicted 255
3 SASI_Hs01_00214420 predicted 258
4 SASI_Hs01_00214421 predicted 795
5 SASI_Hs01_00214422 predicted 249
6 SASI_Hs01_00214424 predicted 1156
7 SASI_Hs01_00214425 predicted 265
8 SASI_Hs01_00214426 predicted 1148
9 SASI_Hs01_00214427 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114239 predicted 737
2 SASI_Rn01_00114241 predicted 1234
3 SASI_Rn01_00114242 predicted 1281
4 SASI_Rn02_00265238 predicted 1120
5 SASI_Rn01_00114245 predicted 986
6 SASI_Rn01_00114247 predicted 1283
7 SASI_Rn01_00114248 predicted 1105
8 SASI_Rn02_00265239 predicted 991
9 SASI_Rn02_00265240 predicted 801
10 SASI_Rn02_00265241 predicted 462
11 SASI_Rn01_00114240 predicted 422
12 SASI_Rn01_00114243 predicted 957
13 SASI_Rn01_00114244 predicted 389
14 SASI_Rn01_00114246 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144866 predicted 287
2 SASI_Mm01_00144867 predicted 1297
3 SASI_Mm01_00144868 predicted 1269
4 SASI_Mm02_00312152 predicted 813
5 SASI_Mm01_00144870 predicted 830
6 SASI_Mm01_00144871 predicted 1001
7 SASI_Mm02_00312153 predicted 276
8 SASI_Mm02_00312154 predicted 1313
9 SASI_Mm02_00312155 predicted 1341
10 SASI_Mm01_00144873 predicted 1004
11 SASI_Mm01_00144869 predicted 1302
12 SASI_Mm01_00144872 predicted 1299
13 SASI_Mm01_00144874 predicted 761
14 SASI_Mm01_00144875 predicted 1000
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007656
CD82 MISSION shRNA Bacterial Glycerol Stock
CD82 molecule
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007656.4-1339s21c1
Sequence:GTACCGGGTCTCCACCCTGAAGTCATATCTCGAGATATGACTTCAGGGTGGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007656.4-833s21c1
Sequence:GTACCGGAGGATTCTGTGAGGCTGATAACTCGAGTTATCAGCCTCACAGAATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-221s1c1
Sequence:CCGGGCTTCATTTCCGTCCTACAAACTCGAGTTTGTAGGACGGAAATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-861s1c1
Sequence:CCGGGTACATTCATTCTGAAGACTACTCGAGTAGTCTTCAGAATGAATGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-417s1c1
Sequence:CCGGCTTCTACTTCAACGCTGACAACTCGAGTTGTCAGCGTTGAAGTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-465s1c1
Sequence:CCGGGATGGACATCATTCGCAACTACTCGAGTAGTTGCGAATGATGTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-625s1c1
Sequence:CCGGTCCTGCGAGAAGATCAAGGAACTCGAGTTCCTTGATCTTCTCGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007656
CD82 MISSION shRNA shRNA Plasmid DNA
CD82 molecule
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007656.4-1339s21c1
Sequence:GTACCGGGTCTCCACCCTGAAGTCATATCTCGAGATATGACTTCAGGGTGGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007656.4-833s21c1
Sequence:GTACCGGAGGATTCTGTGAGGCTGATAACTCGAGTTATCAGCCTCACAGAATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-221s1c1
Sequence:CCGGGCTTCATTTCCGTCCTACAAACTCGAGTTTGTAGGACGGAAATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-861s1c1
Sequence:CCGGGTACATTCATTCTGAAGACTACTCGAGTAGTCTTCAGAATGAATGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-417s1c1
Sequence:CCGGCTTCTACTTCAACGCTGACAACTCGAGTTGTCAGCGTTGAAGTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-465s1c1
Sequence:CCGGGATGGACATCATTCGCAACTACTCGAGTAGTTGCGAATGATGTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-625s1c1
Sequence:CCGGTCCTGCGAGAAGATCAAGGAACTCGAGTTCCTTGATCTTCTCGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007656
CD82 MISSION shRNA Lentiviral Transduction Particles
CD82 molecule
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007656.4-1339s21c1
Sequence:GTACCGGGTCTCCACCCTGAAGTCATATCTCGAGATATGACTTCAGGGTGGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007656.4-833s21c1
Sequence:GTACCGGAGGATTCTGTGAGGCTGATAACTCGAGTTATCAGCCTCACAGAATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-221s1c1
Sequence:CCGGGCTTCATTTCCGTCCTACAAACTCGAGTTTGTAGGACGGAAATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-861s1c1
Sequence:CCGGGTACATTCATTCTGAAGACTACTCGAGTAGTCTTCAGAATGAATGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-417s1c1
Sequence:CCGGCTTCTACTTCAACGCTGACAACTCGAGTTGTCAGCGTTGAAGTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-465s1c1
Sequence:CCGGGATGGACATCATTCGCAACTACTCGAGTAGTTGCGAATGATGTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007656.1-625s1c1
Sequence:CCGGTCCTGCGAGAAGATCAAGGAACTCGAGTTCCTTGATCTTCTCGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002231
VALIDATED
CD82 MISSION shRNA Bacterial Glycerol Stock
CD82 molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002231.3-604s21c1
Sequence:CCGGGCATCGTGACTGAGCTCATTCCTCGAGGAATGAGCTCAGTCACGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002231.3-727s21c1
Sequence:CCGGACAACGCTGAGCTCATGAATCCTCGAGGATTCATGAGCTCAGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002231.3-1010s21c1
Sequence:CCGGGCACGTCCATTCCGAAGACTACTCGAGTAGTCTTCGGAATGGACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002231.3-1160s21c1
Sequence:CCGGCTTGCCCATCCTGACTGAAAGCTCGAGCTTTCAGTCAGGATGGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002231.3-292s21c1
Sequence:CCGGTCTTCAACTTGATCTTCTTTACTCGAGTAAAGAAGATCAAGTTGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002231.2-949s1c1
Sequence:CCGGCCATTCCGAAGACTACAGCAACTCGAGTTGCTGTAGTCTTCGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002231.2-300s1c1
Sequence:CCGGGTTTCATCTCTGTCCTGCAAACTCGAGTTTGCAGGACAGAGATGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002231.2-643s1c1
Sequence:CCGGCTTCTACAACTGGACAGACAACTCGAGTTGTCTGTCCAGTTGTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_002231.2-496s1c1
Sequence:CCGGCTTCTACTTCAACATGGGCAACTCGAGTTGCCCATGTTGAAGTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002231
VALIDATED
CD82 MISSION shRNA shRNA Plasmid DNA
CD82 molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002231.3-604s21c1
Sequence:CCGGGCATCGTGACTGAGCTCATTCCTCGAGGAATGAGCTCAGTCACGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002231.3-727s21c1
Sequence:CCGGACAACGCTGAGCTCATGAATCCTCGAGGATTCATGAGCTCAGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002231.3-1010s21c1
Sequence:CCGGGCACGTCCATTCCGAAGACTACTCGAGTAGTCTTCGGAATGGACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002231.3-1160s21c1
Sequence:CCGGCTTGCCCATCCTGACTGAAAGCTCGAGCTTTCAGTCAGGATGGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002231.3-292s21c1
Sequence:CCGGTCTTCAACTTGATCTTCTTTACTCGAGTAAAGAAGATCAAGTTGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002231.2-949s1c1
Sequence:CCGGCCATTCCGAAGACTACAGCAACTCGAGTTGCTGTAGTCTTCGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002231.2-300s1c1
Sequence:CCGGGTTTCATCTCTGTCCTGCAAACTCGAGTTTGCAGGACAGAGATGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002231.2-643s1c1
Sequence:CCGGCTTCTACAACTGGACAGACAACTCGAGTTGTCTGTCCAGTTGTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_002231.2-496s1c1
Sequence:CCGGCTTCTACTTCAACATGGGCAACTCGAGTTGCCCATGTTGAAGTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002231
VALIDATED
CD82 MISSION shRNA Lentiviral Transduction Particles
CD82 molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002231.3-604s21c1
Sequence:CCGGGCATCGTGACTGAGCTCATTCCTCGAGGAATGAGCTCAGTCACGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002231.3-727s21c1
Sequence:CCGGACAACGCTGAGCTCATGAATCCTCGAGGATTCATGAGCTCAGCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002231.3-1010s21c1
Sequence:CCGGGCACGTCCATTCCGAAGACTACTCGAGTAGTCTTCGGAATGGACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002231.3-1160s21c1
Sequence:CCGGCTTGCCCATCCTGACTGAAAGCTCGAGCTTTCAGTCAGGATGGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002231.3-292s21c1
Sequence:CCGGTCTTCAACTTGATCTTCTTTACTCGAGTAAAGAAGATCAAGTTGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002231.2-949s1c1
Sequence:CCGGCCATTCCGAAGACTACAGCAACTCGAGTTGCTGTAGTCTTCGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002231.2-300s1c1
Sequence:CCGGGTTTCATCTCTGTCCTGCAAACTCGAGTTTGCAGGACAGAGATGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002231.2-643s1c1
Sequence:CCGGCTTCTACAACTGGACAGACAACTCGAGTTGTCTGTCCAGTTGTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_002231.2-496s1c1
Sequence:CCGGCTTCTACTTCAACATGGGCAACTCGAGTTGCCCATGTTGAAGTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)