EMAIL THIS PAGE TO A FRIEND

CD83

CD83 molecule

157 Gene Product Result for
Synonyms: BL11 HB15
UniProtKB ID: Q01151, Q5THX9
Gene ID:
Human(9308) Summary: The protein encoded by this gene is a single-pass type I membrane protein and member of the immunoglobulin superfamily of receptors. The encoded protein may be involved in the regulation of antigen presentation. A soluble form of this protein can bind to dendritic cells and inhibit their maturation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(12522) CD83 antigen
Rat(361226) CD83 molecule
chicken(420838) CD83 molecule
domestic cat(101091695) CD83 molecule
cow(617034) CD83 molecule
dog(610141) CD83 molecule
sheep(101103355) CD83 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1352 Human CD83 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004233 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130131 MISSION® esiRNA esiRNA human CD83 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040280 Rosetta Predictions human pricing
NM_004233 Rosetta Predictions human pricing
NM_001108410 Rosetta Predictions rat pricing
NM_009856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065420 predicted 330
2 SASI_Hs01_00065421 predicted 1046
3 SASI_Hs01_00065422 predicted 1255
4 SASI_Hs02_00308928 predicted 1105
5 SASI_Hs01_00065423 predicted 886
6 SASI_Hs01_00065424 predicted 240
7 SASI_Hs01_00065425 predicted 193
8 SASI_Hs01_00065426 predicted 1076
9 SASI_Hs02_00308929 predicted 1098
10 SASI_Hs01_00065427 predicted 1036
11 SASI_Hs01_00065428 predicted 1247
12 SASI_Hs01_00065429 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057163 predicted 329
2 SASI_Hs01_00057164 predicted 1046
3 SASI_Hs01_00057165 predicted 1260
4 SASI_Hs02_00337157 predicted 1105
5 SASI_Hs01_00057166 predicted 890
6 SASI_Hs01_00057167 predicted 242
7 SASI_Hs01_00057168 predicted 200
8 SASI_Hs01_00057169 predicted 1083
9 SASI_Hs02_00337158 predicted 1107
10 SASI_Hs01_00057170 predicted 1034
11 SASI_Hs01_00057171 predicted 1251
12 SASI_Hs01_00057172 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238389 predicted 467
2 SASI_Rn02_00238390 predicted 1070
3 SASI_Rn02_00238391 predicted 674
4 SASI_Rn02_00238392 predicted 929
5 SASI_Rn02_00238393 predicted 1115
6 SASI_Rn02_00238394 predicted 402
7 SASI_Rn02_00238395 predicted 875
8 SASI_Rn02_00238396 predicted 865
9 SASI_Rn02_00238397 predicted 967
10 SASI_Rn02_00238398 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317251 predicted 1075
2 SASI_Mm02_00317252 predicted 499
3 SASI_Mm01_00129318 predicted 474
4 SASI_Mm02_00317253 predicted 967
5 SASI_Mm02_00317254 predicted 989
6 SASI_Mm01_00129320 predicted 692
7 SASI_Mm01_00129322 predicted 346
8 SASI_Mm02_00317255 predicted 661
9 SASI_Mm02_00317256 predicted 790
10 SASI_Mm01_00129323 predicted 1060
11 SASI_Mm01_00129317 predicted 979
12 SASI_Mm01_00129319 predicted 758
13 SASI_Mm01_00129321 predicted 995
14 SASI_Mm01_00129324 predicted 476
15 SASI_Mm01_00129325 predicted 830
16 SASI_Mm01_00129326 predicted 1001
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004233
VALIDATED
CD83 MISSION shRNA Bacterial Glycerol Stock
CD83 molecule
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004233.2-583s1c1
Sequence:CCGGCCCTGAAGATCCGAAACACTACTCGAGTAGTGTTTCGGATCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004233.2-795s1c1
Sequence:CCGGACTTGTAAGTTTGCACGGCTACTCGAGTAGCCGTGCAAACTTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004233.2-704s1c1
Sequence:CCGGACAGCGTAAAGAAGAGACTTTCTCGAGAAAGTCTCTTCTTTACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004233.2-653s1c1
Sequence:CCGGGCAGAGAAACCTAAGTGGCAACTCGAGTTGCCACTTAGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004233.2-815s1c1
Sequence:CCGGACAGAGTATCTTCCCAGATTTCTCGAGAAATCTGGGAAGATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-682s21c1
Sequence:CCGGACAGAGTATCTTCCCAGATTTCTCGAGAAATCTGGGAAGATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-571s21c1
Sequence:CCGGACAGCGTAAAGAAGAGACTTTCTCGAGAAAGTCTCTTCTTTACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-662s21c1
Sequence:CCGGACTTGTAAGTTTGCACGGCTACTCGAGTAGCCGTGCAAACTTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-520s21c1
Sequence:CCGGGCAGAGAAACCTAAGTGGCAACTCGAGTTGCCACTTAGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-450s21c1
Sequence:CCGGCCCTGAAGATCCGAAACACTACTCGAGTAGTGTTTCGGATCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004233
VALIDATED
CD83 MISSION shRNA shRNA Plasmid DNA
CD83 molecule
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004233.2-583s1c1
Sequence:CCGGCCCTGAAGATCCGAAACACTACTCGAGTAGTGTTTCGGATCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004233.2-795s1c1
Sequence:CCGGACTTGTAAGTTTGCACGGCTACTCGAGTAGCCGTGCAAACTTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004233.2-704s1c1
Sequence:CCGGACAGCGTAAAGAAGAGACTTTCTCGAGAAAGTCTCTTCTTTACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004233.2-653s1c1
Sequence:CCGGGCAGAGAAACCTAAGTGGCAACTCGAGTTGCCACTTAGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004233.2-815s1c1
Sequence:CCGGACAGAGTATCTTCCCAGATTTCTCGAGAAATCTGGGAAGATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-682s21c1
Sequence:CCGGACAGAGTATCTTCCCAGATTTCTCGAGAAATCTGGGAAGATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-571s21c1
Sequence:CCGGACAGCGTAAAGAAGAGACTTTCTCGAGAAAGTCTCTTCTTTACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-662s21c1
Sequence:CCGGACTTGTAAGTTTGCACGGCTACTCGAGTAGCCGTGCAAACTTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-520s21c1
Sequence:CCGGGCAGAGAAACCTAAGTGGCAACTCGAGTTGCCACTTAGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-450s21c1
Sequence:CCGGCCCTGAAGATCCGAAACACTACTCGAGTAGTGTTTCGGATCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004233
VALIDATED
CD83 MISSION shRNA Lentiviral Transduction Particles
CD83 molecule
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004233.2-583s1c1
Sequence:CCGGCCCTGAAGATCCGAAACACTACTCGAGTAGTGTTTCGGATCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004233.2-795s1c1
Sequence:CCGGACTTGTAAGTTTGCACGGCTACTCGAGTAGCCGTGCAAACTTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004233.2-704s1c1
Sequence:CCGGACAGCGTAAAGAAGAGACTTTCTCGAGAAAGTCTCTTCTTTACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004233.2-653s1c1
Sequence:CCGGGCAGAGAAACCTAAGTGGCAACTCGAGTTGCCACTTAGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004233.2-815s1c1
Sequence:CCGGACAGAGTATCTTCCCAGATTTCTCGAGAAATCTGGGAAGATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-682s21c1
Sequence:CCGGACAGAGTATCTTCCCAGATTTCTCGAGAAATCTGGGAAGATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-571s21c1
Sequence:CCGGACAGCGTAAAGAAGAGACTTTCTCGAGAAAGTCTCTTCTTTACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-662s21c1
Sequence:CCGGACTTGTAAGTTTGCACGGCTACTCGAGTAGCCGTGCAAACTTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-520s21c1
Sequence:CCGGGCAGAGAAACCTAAGTGGCAACTCGAGTTGCCACTTAGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004233.3-450s21c1
Sequence:CCGGCCCTGAAGATCCGAAACACTACTCGAGTAGTGTTTCGGATCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009856
CD83 MISSION shRNA Bacterial Glycerol Stock
CD83 molecule
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009856.1-1358s1c1
Sequence:CCGGGCCTGAGAGAAGATGGAGAATCTCGAGATTCTCCATCTTCTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009856.1-375s1c1
Sequence:CCGGCCAAGGAAGCTACAGAGTCAACTCGAGTTGACTCTGTAGCTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009856.1-474s1c1
Sequence:CCGGGCAAATTTGCACGACTACAAACTCGAGTTTGTAGTCGTGCAAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009856.1-576s1c1
Sequence:CCGGTGACCCTTCCTAAGACAGAAACTCGAGTTTCTGTCTTAGGAAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009856.1-252s1c1
Sequence:CCGGCCTATTCCCTGACGATCCAAACTCGAGTTTGGATCGTCAGGGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009856.2-737s21c1
Sequence:CCGGTCAGATCAGTGTGCCTGAATGCTCGAGCATTCAGGCACACTGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009856.2-697s21c1
Sequence:CCGGGAGTAGGATCTCCACTGGTTTCTCGAGAAACCAGTGGAGATCCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009856.2-905s21c1
Sequence:CCGGTCTGTGGCTGTCAGCTTAATGCTCGAGCATTAAGCTGACAGCCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009856
CD83 MISSION shRNA shRNA Plasmid DNA
CD83 molecule
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009856.1-1358s1c1
Sequence:CCGGGCCTGAGAGAAGATGGAGAATCTCGAGATTCTCCATCTTCTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009856.1-375s1c1
Sequence:CCGGCCAAGGAAGCTACAGAGTCAACTCGAGTTGACTCTGTAGCTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009856.1-474s1c1
Sequence:CCGGGCAAATTTGCACGACTACAAACTCGAGTTTGTAGTCGTGCAAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009856.1-576s1c1
Sequence:CCGGTGACCCTTCCTAAGACAGAAACTCGAGTTTCTGTCTTAGGAAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009856.1-252s1c1
Sequence:CCGGCCTATTCCCTGACGATCCAAACTCGAGTTTGGATCGTCAGGGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009856.2-737s21c1
Sequence:CCGGTCAGATCAGTGTGCCTGAATGCTCGAGCATTCAGGCACACTGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009856.2-697s21c1
Sequence:CCGGGAGTAGGATCTCCACTGGTTTCTCGAGAAACCAGTGGAGATCCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009856.2-905s21c1
Sequence:CCGGTCTGTGGCTGTCAGCTTAATGCTCGAGCATTAAGCTGACAGCCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009856
CD83 MISSION shRNA Lentiviral Transduction Particles
CD83 molecule
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009856.1-1358s1c1
Sequence:CCGGGCCTGAGAGAAGATGGAGAATCTCGAGATTCTCCATCTTCTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009856.1-375s1c1
Sequence:CCGGCCAAGGAAGCTACAGAGTCAACTCGAGTTGACTCTGTAGCTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009856.1-474s1c1
Sequence:CCGGGCAAATTTGCACGACTACAAACTCGAGTTTGTAGTCGTGCAAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009856.1-576s1c1
Sequence:CCGGTGACCCTTCCTAAGACAGAAACTCGAGTTTCTGTCTTAGGAAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009856.1-252s1c1
Sequence:CCGGCCTATTCCCTGACGATCCAAACTCGAGTTTGGATCGTCAGGGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009856.2-737s21c1
Sequence:CCGGTCAGATCAGTGTGCCTGAATGCTCGAGCATTCAGGCACACTGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009856.2-697s21c1
Sequence:CCGGGAGTAGGATCTCCACTGGTTTCTCGAGAAACCAGTGGAGATCCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009856.2-905s21c1
Sequence:CCGGTCTGTGGCTGTCAGCTTAATGCTCGAGCATTAAGCTGACAGCCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks