EMAIL THIS PAGE TO A FRIEND

CD84

CD84 molecule

202 Gene Product Result for
Synonyms: LY9B SLAMF5 hCD84 mCD84
Gene ID:
Human(8832) Summary: This gene encodes a membrane glycoprotein that is a member of the signaling lymphocyte activation molecule (SLAM) family. This family forms a subset of the larger CD2 cell-surface receptor Ig superfamily. The encoded protein is a homophilic adhesion molecule that is expressed in numerous immune cells types and is involved in regulating receptor-mediated signaling in those cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Mouse(12523) CD84 antigen
Rat(501872) CD84 molecule
cow(510910) CD84 molecule
domestic cat(101090079) CD84 molecule
dog(488641) CD84 molecule
sheep(101102779) CD84 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1353 Human CD84 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003874 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013489 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013489 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013489 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061601 MISSION® esiRNA esiRNA human CD84 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003874 Rosetta Predictions human pricing
XM_001054923 Rosetta Predictions rat pricing
XM_577290 Rosetta Predictions rat pricing
NM_013489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118446 predicted 451
2 SASI_Hs01_00118447 predicted 1093
3 SASI_Hs01_00118448 predicted 983
4 SASI_Hs02_00336465 predicted 335
5 SASI_Hs01_00118449 predicted 480
6 SASI_Hs01_00118450 predicted 217
7 SASI_Hs01_00118451 predicted 543
8 SASI_Hs01_00118452 predicted 387
9 SASI_Hs01_00118454 predicted 617
10 SASI_Hs01_00118455 predicted 852
11 SASI_Hs01_00118453 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277724 predicted 685
2 SASI_Rn02_00277725 predicted 369
3 SASI_Rn02_00277726 predicted 559
4 SASI_Rn02_00277727 predicted 502
5 SASI_Rn02_00277728 predicted 341
6 SASI_Rn02_00277729 predicted 524
7 SASI_Rn02_00277730 predicted 418
8 SASI_Rn02_00277731 predicted 347
9 SASI_Rn02_00277732 predicted 644
10 SASI_Rn02_00277733 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406428 predicted 685
2 SASI_Rn02_00406429 predicted 372
3 SASI_Rn02_00406430 predicted 555
4 SASI_Rn02_00406431 predicted 504
5 SASI_Rn02_00406432 predicted 345
6 SASI_Rn02_00406433 predicted 524
7 SASI_Rn02_00406434 predicted 417
8 SASI_Rn02_00406435 predicted 349
9 SASI_Rn02_00406436 predicted 642
10 SASI_Rn02_00406437 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322128 predicted 1053
2 SASI_Mm01_00176920 predicted 283
3 SASI_Mm02_00322129 predicted 1044
4 SASI_Mm01_00176922 predicted 440
5 SASI_Mm01_00176923 predicted 498
6 SASI_Mm01_00176924 predicted 586
7 SASI_Mm01_00176925 predicted 770
8 SASI_Mm01_00176926 predicted 369
9 SASI_Mm01_00176927 predicted 485
10 SASI_Mm01_00176928 predicted 412
11 SASI_Mm01_00176921 predicted 257
12 SASI_Mm01_00176929 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003874
CD84 MISSION shRNA Bacterial Glycerol Stock
CD84 molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003874.2-154s21c1
Sequence:CCGGCAAGAACCACGGCAAGTTAAACTCGAGTTTAACTTGCCGTGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003874.2-1234s21c1
Sequence:CCGGCAAAGCAGGTTACCTAGTATACTCGAGTATACTAGGTAACCTGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003874.2-1303s21c1
Sequence:CCGGTTATGGCACACTGGGATAAACCTCGAGGTTTATCCCAGTGTGCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-735s1c1
Sequence:CCGGGCTATGTTCTTTCTGCTTGTTCTCGAGAACAAGCAGAAAGAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-312s1c1
Sequence:CCGGCCGAACTACAATCTGGTCATTCTCGAGAATGACCAGATTGTAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-869s1c1
Sequence:CCGGGTCCAGAATCTATGATGAAATCTCGAGATTTCATCATAGATTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-999s1c1
Sequence:CCGGCCTGGGACTTCAAGCTATGAACTCGAGTTCATAGCTTGAAGTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-411s1c1
Sequence:CCGGCGCTACAACCTGCAAATCTATCTCGAGATAGATTTGCAGGTTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003874
CD84 MISSION shRNA shRNA Plasmid DNA
CD84 molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003874.2-154s21c1
Sequence:CCGGCAAGAACCACGGCAAGTTAAACTCGAGTTTAACTTGCCGTGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003874.2-1234s21c1
Sequence:CCGGCAAAGCAGGTTACCTAGTATACTCGAGTATACTAGGTAACCTGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003874.2-1303s21c1
Sequence:CCGGTTATGGCACACTGGGATAAACCTCGAGGTTTATCCCAGTGTGCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-735s1c1
Sequence:CCGGGCTATGTTCTTTCTGCTTGTTCTCGAGAACAAGCAGAAAGAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-312s1c1
Sequence:CCGGCCGAACTACAATCTGGTCATTCTCGAGAATGACCAGATTGTAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-869s1c1
Sequence:CCGGGTCCAGAATCTATGATGAAATCTCGAGATTTCATCATAGATTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-999s1c1
Sequence:CCGGCCTGGGACTTCAAGCTATGAACTCGAGTTCATAGCTTGAAGTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-411s1c1
Sequence:CCGGCGCTACAACCTGCAAATCTATCTCGAGATAGATTTGCAGGTTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003874
CD84 MISSION shRNA Lentiviral Transduction Particles
CD84 molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003874.2-154s21c1
Sequence:CCGGCAAGAACCACGGCAAGTTAAACTCGAGTTTAACTTGCCGTGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003874.2-1234s21c1
Sequence:CCGGCAAAGCAGGTTACCTAGTATACTCGAGTATACTAGGTAACCTGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003874.2-1303s21c1
Sequence:CCGGTTATGGCACACTGGGATAAACCTCGAGGTTTATCCCAGTGTGCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-735s1c1
Sequence:CCGGGCTATGTTCTTTCTGCTTGTTCTCGAGAACAAGCAGAAAGAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-312s1c1
Sequence:CCGGCCGAACTACAATCTGGTCATTCTCGAGAATGACCAGATTGTAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-869s1c1
Sequence:CCGGGTCCAGAATCTATGATGAAATCTCGAGATTTCATCATAGATTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-999s1c1
Sequence:CCGGCCTGGGACTTCAAGCTATGAACTCGAGTTCATAGCTTGAAGTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003874.1-411s1c1
Sequence:CCGGCGCTACAACCTGCAAATCTATCTCGAGATAGATTTGCAGGTTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013489
CD84 MISSION shRNA Bacterial Glycerol Stock
CD84 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-130s1c1
Sequence:CCGGCCGGTGGTAATGAATGGGATTCTCGAGAATCCCATTCATTACCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-247s1c1
Sequence:CCGGCCAGGAGTCAATAAAGCTGAACTCGAGTTCAGCTTTATTGACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-820s1c1
Sequence:CCGGGCAGATGATGTCTCAAAGAAACTCGAGTTTCTTTGAGACATCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-373s1c1
Sequence:CCGGGCAGACATCAATGAAGAGAATCTCGAGATTCTCTTCATTGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-733s1c1
Sequence:CCGGGCCGTGCTCTTTCTGCTTATTCTCGAGAATAAGCAGAAAGAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013489
CD84 MISSION shRNA shRNA Plasmid DNA
CD84 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-130s1c1
Sequence:CCGGCCGGTGGTAATGAATGGGATTCTCGAGAATCCCATTCATTACCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-247s1c1
Sequence:CCGGCCAGGAGTCAATAAAGCTGAACTCGAGTTCAGCTTTATTGACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-820s1c1
Sequence:CCGGGCAGATGATGTCTCAAAGAAACTCGAGTTTCTTTGAGACATCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-373s1c1
Sequence:CCGGGCAGACATCAATGAAGAGAATCTCGAGATTCTCTTCATTGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-733s1c1
Sequence:CCGGGCCGTGCTCTTTCTGCTTATTCTCGAGAATAAGCAGAAAGAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013489
CD84 MISSION shRNA Lentiviral Transduction Particles
CD84 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-130s1c1
Sequence:CCGGCCGGTGGTAATGAATGGGATTCTCGAGAATCCCATTCATTACCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-247s1c1
Sequence:CCGGCCAGGAGTCAATAAAGCTGAACTCGAGTTCAGCTTTATTGACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-820s1c1
Sequence:CCGGGCAGATGATGTCTCAAAGAAACTCGAGTTTCTTTGAGACATCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-373s1c1
Sequence:CCGGGCAGACATCAATGAAGAGAATCTCGAGATTCTCTTCATTGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013489.1-733s1c1
Sequence:CCGGGCCGTGCTCTTTCTGCTTATTCTCGAGAATAAGCAGAAAGAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks