EMAIL THIS PAGE TO A FRIEND

CD86

CD86 molecule

183 Gene Product Result for
Synonyms: B7-2 B7.2 B70 CD28LG2 LAB72
Gene ID:
Human(942) Summary: This gene encodes a type I membrane protein that is a member of the immunoglobulin superfamily. This protein is expressed by antigen-presenting cells, and it is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of this protein with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of this protein with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response. Alternative splicing results in several transcript variants encoding different isoforms.[provided by RefSeq, May 2011]
Mouse(12524) CD86 antigen
Rat(56822) CD86 molecule
chicken(427944) CD86 molecule
cow(414345) CD86 molecule
domestic cat(493704) CD86 molecule
dog(403764) CD86 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411654 Anti-CD86 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4700563 Anti-Cd8a low endotoxin antibody, Rat monoclonal clone 53-6.7, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation pricing
WH0000942M1 Monoclonal Anti-CD86 antibody produced in mouse clone 3D7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB4700144 Monoclonal Anti-CD86 antibody produced in mouse clone BU63, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700560 Monoclonal Anti-Cd86 antibody produced in rat clone GL-1, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700561 Monoclonal Anti-Cd86 low endotoxin antibody produced in rat clone GL-1, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700145 Monoclonal Anti-CD86-APC antibody produced in mouse clone BU63, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700146 Monoclonal Anti-CD86-FITC antibody produced in mouse clone BU63, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700562 Monoclonal Anti-Cd86-FITC antibody produced in rat clone GL-1, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700147 Monoclonal Anti-CD86-PE antibody produced in mouse clone BU63, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700564 Monoclonal Anti-Cd8a-APC antibody produced in rat clone 53-6.7, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700565 Monoclonal Anti-Cd8a-FITC antibody produced in rat clone 53-6.7, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700566 Monoclonal Anti-Cd8a-PE antibody produced in rat clone 53-6.7, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006889 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083111 MISSION® esiRNA esiRNA human CD86 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
04-1528 Anti-CD86 Antibody, clone IT2.2 50 µL, Anti-CD86 Antibody, clone IT2.2 detects level of CD86 & has been published & validated for use in FC, WB, IH. pricing
04-1527 Anti-CD86 Antibody, clone PO.3 100 µg, Anti-CD86 Antibody, clone PO.3 is an antibody against CD86 for use in FC, IP, IH. pricing
MABF459 Anti-CD86 (B7-2) Antibody (human), PE, clone IT2.2 100 tests, This mouse monoclonal antibody Anti-CD86 (B7-2) (human), PE, clone IT2.2 validated for use in western blotting, IHC & Flow Cytometry for the detection of CD86 (B7-2). pricing
MABF727 Anti-CD86 (B7-2) Antibody (human), PE, clone IT2.2 25 tests, This mouse monoclonal antibody Anti-CD86 (B7-2) (human), PE, clone IT2.2 validated for use in western blotting, IHC & Flow Cytometry for the detection of CD86 (B7-2). pricing
MABF456 Anti-CD86 (B7-2) Antibody (mouse), APC, clone GL-1 100 µg, This rat monoclonal antibody Anti-CD86 (B7-2) (mouse), APC, clone GL-1 validated for use in IHC, Immunofluorescence & Flow Cytometry for the detection of CD86 (B7-2). pricing
MABF723 Anti-CD86 (B7-2) Antibody (mouse), APC, clone GL-1 25 µg, This rat monoclonal antibody Anti-CD86 (B7-2) (mouse), APC, clone GL-1 validated for use in IHC, Immunofluorescence & Flow Cytometry for the detection of CD86 (B7-2). pricing
MABF457 Anti-CD86 (B7-2) Antibody (mouse), FITC, clone GL-1 100 µg, This rat monoclonal antibody Anti-CD86 (B7-2) (mouse), FITC, clone GL-1 validated for use in IHC, Immunofluorescence & Flow Cytometry for the detection of CD86 (B7-2). pricing
MABF724 Anti-CD86 (B7-2) Antibody (mouse), FITC, clone GL-1 25 µg, This rat monoclonal antibody Anti-CD86 (B7-2) (mouse), FITC, clone GL-1 validated for use in IHC, Immunofluorescence & Flow Cytometry for the detection of CD86 (B7-2). pricing
MABF725 Anti-CD86 (B7-2) Antibody (mouse), FITC, clone GL-1 500 µg, This rat monoclonal antibody Anti-CD86 (B7-2) (mouse), FITC, clone GL-1 validated for use in IHC, Immunofluorescence & Flow Cytometry for the detection of CD86 (B7-2). pricing
MABF458 Anti-CD86 (B7-2) Antibody (mouse), PE, clone GL-1 100 µg, This rat monoclonal antibody Anti-CD86 (B7-2) (mouse), PE, clone GL-1 validated for use in IHC, Immunofluorescence & Flow Cytometry for the detection of CD86 (B7-2). pricing
MABF726 Anti-CD86 (B7-2) Antibody (mouse), PE, clone GL-1 25 µg, This rat monoclonal antibody Anti-CD86 (B7-2) (mouse), PE, clone GL-1 validated for use in IHC, Immunofluorescence & Flow Cytometry for the detection of CD86 (B7-2). pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006889 Rosetta Predictions human pricing
NM_175862 Rosetta Predictions human pricing
NM_020081 Rosetta Predictions rat pricing
NM_019388 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067684 predicted 1029
2 SASI_Hs01_00067685 predicted 1042
3 SASI_Hs01_00067686 predicted 1208
4 SASI_Hs01_00067687 predicted 534
5 SASI_Hs01_00067688 predicted 652
6 SASI_Hs01_00067690 predicted 445
7 SASI_Hs01_00067691 predicted 528
8 SASI_Hs01_00067692 predicted 672
9 SASI_Hs01_00067693 predicted 878
10 SASI_Hs02_00342555 predicted 527
11 SASI_Hs01_00067689 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112234 predicted 1009
2 SASI_Hs01_00112235 predicted 1027
3 SASI_Hs01_00112236 predicted 1195
4 SASI_Hs01_00112237 predicted 528
5 SASI_Hs01_00112238 predicted 634
6 SASI_Hs01_00112240 predicted 433
7 SASI_Hs01_00112241 predicted 516
8 SASI_Hs01_00112242 predicted 657
9 SASI_Hs01_00112243 predicted 866
10 SASI_Hs02_00369138 predicted 508
11 SASI_Hs01_00112239 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044638 predicted 452
2 SASI_Rn01_00044639 predicted 676
3 SASI_Rn01_00044640 predicted 412
4 SASI_Rn02_00262489 predicted 466
5 SASI_Rn01_00044641 predicted 391
6 SASI_Rn02_00262490 predicted 560
7 SASI_Rn01_00044642 predicted 225
8 SASI_Rn01_00044643 predicted 363
9 SASI_Rn01_00044644 predicted 457
10 SASI_Rn01_00044645 predicted 425
11 SASI_Rn01_00044646 predicted 537
12 SASI_Rn01_00044647 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020366 predicted 469
2 SASI_Mm01_00020367 predicted 311
3 SASI_Mm01_00020369 predicted 1134
4 SASI_Mm01_00020370 predicted 642
5 SASI_Mm01_00020371 predicted 780
6 SASI_Mm01_00020374 predicted 933
7 SASI_Mm02_00324308 predicted 817
8 SASI_Mm02_00324309 predicted 198
9 SASI_Mm02_00324310 predicted 228
10 SASI_Mm02_00324311 predicted 568
11 SASI_Mm01_00020368 predicted 535
12 SASI_Mm01_00020372 predicted 537
13 SASI_Mm01_00020373 predicted 607
14 SASI_Mm01_00020375 predicted 796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006889
CD86 MISSION shRNA Bacterial Glycerol Stock
CD86 molecule
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006889.2-750s1c1
Sequence:CCGGCCCTGATGTTACGAGCAATATCTCGAGATATTGCTCGTAACATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006889.2-596s1c1
Sequence:CCGGCCTGCTCATCTATACACGGTTCTCGAGAACCGTGTATAGATGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006889.2-856s1c1
Sequence:CCGGCCAGACCACATTCCTTGGATTCTCGAGAATCCAAGGAATGTGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006889.2-202s1c1
Sequence:CCGGCCTCTGAAGATTCAAGCTTATCTCGAGATAAGCTTGAATCTTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006889.2-1164s1c1
Sequence:CCGGCCTTTGTAAGTTCCTGGGCAACTCGAGTTGCCCAGGAACTTACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006889
CD86 MISSION shRNA shRNA Plasmid DNA
CD86 molecule
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006889.2-750s1c1
Sequence:CCGGCCCTGATGTTACGAGCAATATCTCGAGATATTGCTCGTAACATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006889.2-596s1c1
Sequence:CCGGCCTGCTCATCTATACACGGTTCTCGAGAACCGTGTATAGATGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006889.2-856s1c1
Sequence:CCGGCCAGACCACATTCCTTGGATTCTCGAGAATCCAAGGAATGTGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006889.2-202s1c1
Sequence:CCGGCCTCTGAAGATTCAAGCTTATCTCGAGATAAGCTTGAATCTTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006889.2-1164s1c1
Sequence:CCGGCCTTTGTAAGTTCCTGGGCAACTCGAGTTGCCCAGGAACTTACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006889
CD86 MISSION shRNA Lentiviral Transduction Particles
CD86 molecule
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006889.2-750s1c1
Sequence:CCGGCCCTGATGTTACGAGCAATATCTCGAGATATTGCTCGTAACATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006889.2-596s1c1
Sequence:CCGGCCTGCTCATCTATACACGGTTCTCGAGAACCGTGTATAGATGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006889.2-856s1c1
Sequence:CCGGCCAGACCACATTCCTTGGATTCTCGAGAATCCAAGGAATGTGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006889.2-202s1c1
Sequence:CCGGCCTCTGAAGATTCAAGCTTATCTCGAGATAAGCTTGAATCTTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006889.2-1164s1c1
Sequence:CCGGCCTTTGTAAGTTCCTGGGCAACTCGAGTTGCCCAGGAACTTACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019388
CD86 MISSION shRNA Bacterial Glycerol Stock
CD86 molecule
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019388.2-2291s1c1
Sequence:CCGGCCCAGACTTAAAGAGAACTTTCTCGAGAAAGTTCTCTTTAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019388.2-209s1c1
Sequence:CCGGGCCCATTTACAAAGGCTCAAACTCGAGTTTGAGCCTTTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019388.2-923s1c1
Sequence:CCGGCCTCTAAGTTAGAGCGGGATACTCGAGTATCCCGCTCTAACTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019388.2-579s1c1
Sequence:CCGGCCCGAAACCTAAGAAGATGTACTCGAGTACATCTTCTTAGGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019388.2-728s1c1
Sequence:CCGGCCGTTGTGTGTGTTCTGGAAACTCGAGTTTCCAGAACACACACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019388.3-1174s21c1
Sequence:CCGGTACACAACAGTGTCCATATTTCTCGAGAAATATGGACACTGTTGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019388.3-304s21c1
Sequence:CCGGTGGTTCTGTACGAGCACTATTCTCGAGAATAGTGCTCGTACAGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019388.3-264s21c1
Sequence:CCGGCTGAGTGAGCTGGTAGTATTTCTCGAGAAATACTACCAGCTCACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019388
CD86 MISSION shRNA shRNA Plasmid DNA
CD86 molecule
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019388.2-2291s1c1
Sequence:CCGGCCCAGACTTAAAGAGAACTTTCTCGAGAAAGTTCTCTTTAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019388.2-209s1c1
Sequence:CCGGGCCCATTTACAAAGGCTCAAACTCGAGTTTGAGCCTTTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019388.2-923s1c1
Sequence:CCGGCCTCTAAGTTAGAGCGGGATACTCGAGTATCCCGCTCTAACTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019388.2-579s1c1
Sequence:CCGGCCCGAAACCTAAGAAGATGTACTCGAGTACATCTTCTTAGGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019388.2-728s1c1
Sequence:CCGGCCGTTGTGTGTGTTCTGGAAACTCGAGTTTCCAGAACACACACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019388.3-1174s21c1
Sequence:CCGGTACACAACAGTGTCCATATTTCTCGAGAAATATGGACACTGTTGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019388.3-304s21c1
Sequence:CCGGTGGTTCTGTACGAGCACTATTCTCGAGAATAGTGCTCGTACAGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019388.3-264s21c1
Sequence:CCGGCTGAGTGAGCTGGTAGTATTTCTCGAGAAATACTACCAGCTCACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019388
CD86 MISSION shRNA Lentiviral Transduction Particles
CD86 molecule
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019388.2-2291s1c1
Sequence:CCGGCCCAGACTTAAAGAGAACTTTCTCGAGAAAGTTCTCTTTAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019388.2-209s1c1
Sequence:CCGGGCCCATTTACAAAGGCTCAAACTCGAGTTTGAGCCTTTGTAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019388.2-923s1c1
Sequence:CCGGCCTCTAAGTTAGAGCGGGATACTCGAGTATCCCGCTCTAACTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019388.2-579s1c1
Sequence:CCGGCCCGAAACCTAAGAAGATGTACTCGAGTACATCTTCTTAGGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019388.2-728s1c1
Sequence:CCGGCCGTTGTGTGTGTTCTGGAAACTCGAGTTTCCAGAACACACACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019388.3-1174s21c1
Sequence:CCGGTACACAACAGTGTCCATATTTCTCGAGAAATATGGACACTGTTGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019388.3-304s21c1
Sequence:CCGGTGGTTCTGTACGAGCACTATTCTCGAGAATAGTGCTCGTACAGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019388.3-264s21c1
Sequence:CCGGCTGAGTGAGCTGGTAGTATTTCTCGAGAAATACTACCAGCTCACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks