EMAIL THIS PAGE TO A FRIEND

CD8A

CD8a molecule

127 Gene Product Result for
Synonyms: CD8 Leu2 MAL p32
UniProtKB ID: P01732, D6W5M8, Q13970, Q4ZG17
Gene ID:
Human(925) Summary: The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class I MHC molecules. The coreceptor functions as either a homodimer composed of two alpha chains or as a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 alpha chain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(12525) CD8 antigen, alpha chain
Rat(24930) CD8a molecule
Zebrafish(677754) CD8 antigen, alpha polypeptide
chicken(428800) CD8a molecule
cow(281060) CD8a molecule
domestic cat(493799) CD8a molecule
dog(403157) CD8a molecule
chicken(403158) CD8a molecule
domestic guinea pig(100379570) CD8 antigen, alpha chain
sheep(101103464) CD8a molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500074 Anti-CD8 antibody, Rabbit monoclonal clone SP16, recombinant, expressed in proprietary host, tissue culture supernatant human (tested)
immunohistochemistry pricing
SAB5500075 Anti-CD8 antibody, Rabbit monoclonal clone SP239, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB1405577 Anti-CD8A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA037756 Anti-CD8A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
C7423 Monoclonal Anti-CD8 antibody produced in mouse clone UCHT-4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700084 Monoclonal Anti-CD8 antibody produced in mouse clone MEM-31, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700089 Monoclonal Anti-CD8 antibody produced in mouse clone MEM-87, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700085 Monoclonal Anti-CD8-APC antibody produced in mouse clone MEM-31, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700086 Monoclonal Anti-CD8-Biotin antibody produced in mouse clone MEM-31, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700087 Monoclonal Anti-CD8-FITC antibody produced in mouse clone MEM-31, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
F0772 Monoclonal Anti-CD8−FITC antibody produced in mouse clone UCHT-4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700088 Monoclonal Anti-CD8-PE antibody produced in mouse clone MEM-31, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
P5560 Monoclonal Anti-CD8−PE antibody produced in mouse clone UCHT-4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
R6260 Monoclonal Anti-CD8−Quantum Red antibody produced in mouse clone UCHT-4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700734 Monoclonal Anti-CD8a antibody produced in mouse clone OX-8, purified immunoglobulin, buffered aqueous solution rat
flow cytometry, FUNC, immunohistochemistry, immunoprecipitation, western blot pricing
SAB1402142 Monoclonal Anti-CD8A antibody produced in mouse clone 4B9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001768 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001768 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001768 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_132621 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132621 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132621 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067981 MISSION® esiRNA esiRNA human CD8A (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MABF167A Anti-CD8 (human), FITC, clone SK1 Antibody 25 tests, Anti-CD8 (human), FITC, clone SK1 Antibody is an antibody against CD8 (human), FITC, clone SK1 for use in Flow Cytometry. pricing
MABF167C Anti-CD8 (human), PE, clone SK1 Antibody 25 tests, This Anti-CD8 (human), PE, clone SK1 Antibody is validated for use in Flow Cytometry for the detection of CD8. pricing
MABF168C Anti-CD8 (human), PerCP, clone SK1 Antibody 25 tests, Anti-CD8 (human), PerCP, clone SK1 Antibody is an antibody against CD8 for use in Flow Cytometry. pricing
MABF169A Anti-CD8 (human), violetFluor™ 450, clone SK1 Antibody 25 tests, This mouse monoclonal Anti-CD8 Antibody (human), violetFluor™ 450, clone SK1, Cat. No. MABF1690 is validated for use in Flow Cytometry, for the detection of CD8. pricing
MABF916 Anti-CD8a (human) Antibody, AlexaFluor®488, clone HIT8a 100 tests, Detect CD8 using this mouse monoclonal antibody, Anti-CD8a (human) Antibody, AlexaFluor®488, clone HIT8a validated for use in Flow Cytometry & IHC. pricing
MABF327 Anti-CD8a (human) Antibody, PE, clone HIT8a 100 tests, Anti-CD8a (human) Antibody, PE, clone HIT8a is a highly specific mouse monoclonal antibody, that targets CD8 & has been tested in Flow Cytometry & IHC. pricing
MABF167B Anti-CD8a (human), FITC, clone RPA-T8 Antibody 25 tests, Anti-CD8a (human), FITC, clone RPA-T8 Antibody is an antibody against CD8a (human), FITC, clone RPA-T8 for use in Flow Cytometry. pricing
MABF167D Anti-CD8a (human), PE, clone RPA-T8 Antibody 25 tests, This Anti-CD8a (human), PE, clone RPA-T8 Antibody is validated for use in Flow Cytometry for the detection of CD8a. pricing
MABF169C Anti-CD8a (human), redFluor™ 710, clone RPA-T8 Antibody 25 tests, This mouse monoclonal Anti-CD8a Antibody (human), redFluor™ 710, clone RPA-T8, Cat. No. MABF1695 is validated for use in Flow Cytometry, for the detection of CD8a. pricing
MABF169B Anti-CD8a (human), violetFluor™ 450, clone RPA-T8 Antibody 25 tests, This mouse monoclonal Anti-CD8a Antibody (human), violetFluor™ 450, clone RPA-T8, Cat. No. MABF1693 is validated for use in Flow Cytometry, for the detection of CD8a. pricing
MABF324 Anti-CD8a (mouse) Antibody, AlexaFluor®647, clone 53-6.7 100 µg, Anti-CD8a (mouse) Antibody, AlexaFluor®647, clone 53-6.7 is a highly specific rat monoclonal antibody, that targets CD8 & has been tested in Flow Cytometry, IHC & IP. pricing
MABF325 Anti-CD8a (mouse) Antibody, PE/Cy5, clone 53-6.7 100 µg, Anti-CD8a (mouse) Antibody, PE/Cy5, clone 53-6.7 is a highly specific rat monoclonal antibody, that targets CD8 & has been tested in Flow Cytometry, IHC & IP. pricing
MABF153C Anti-CD8a (Mouse), APC, clone 53-6.7 Antibody 25 μg, This Anti-CD8a (Mouse), APC, clone 53-6.7 Antibody is validated for use in Flow Cytometry for the detection of CD8a. pricing
MABF153D Anti-CD8a (Mouse), APC-Cy7, clone 53-6.7 Antibody 25 μg, This Anti-CD8a (Mouse), APC-Cy7, clone 53-6.7 Antibody is validated for use in Flow Cytometry for the detection of CD8a. pricing
MABF1549 Anti-CD8a (Mouse), clone 53-6.7 Antibody 100 μg, Anti-CD8a (Mouse), clone 53-6.7 Antibody is an antibody against CD8a for use in Flow Cytometry. pricing
MABF153E Anti-CD8a (Mouse), clone 53-6.7, biotin conjugate Antibody 25 μg, Anti-CD8a (Mouse), clone 53-6.7, biotin conjugate Antibody detects level of CD8a and has been published and validated for use in Flow Cytometry. pricing
MABF154A Anti-CD8a (Mouse), FITC, clone 53-6.7 Antibody 25 μg, This rat monoclonal Anti-CD8a Antibody (Mouse), FITC, clone 53-6.7, Cat. No. MABF1541 is validated for use in Flow Cytometry, for the detection of CD8a. pricing
MABF154B Anti-CD8a (Mouse), PE, clone 53-6.7 Antibody 25 μg, This Anti-CD8a (Mouse), PE, clone 53-6.7 Antibody is validated for use in Flow Cytometry for the detection of CD8a. pricing
MABF154C Anti-CD8a (Mouse), PE-Cy7, clone 53-6.7 Antibody 25 μg, This rat monoclonal Anti-CD8a Antibody (Mouse), PE-Cy7, clone 53-6.7, Cat. No. MABF1546 is validated for use in Flow Cytometry, for the detection of CD8a. pricing
MABF154D Anti-CD8a (Mouse), PerCP-Cy5.5, clone 53-6.7 Antibody 25 μg, This rat monoclonal Anti-CD8a Antibody (Mouse), PerCP-Cy5.5, clone 53-6.7, Cat. No. MABF1548 is validated for use in Flow Cytometry, for the detection of CD8a. pricing
MABF155B Anti-CD8a (Mouse), redFluor™ 710, clone 53-6.7 Antibody 25 μg, Anti-CD8a (Mouse), redFluor™ 710, clone 53-6.7 Antibody detects level of CD8a and has been published and validated for use in Flow Cytometry. pricing
MABF155A Anti-CD8a (Mouse), violetFluor™ 450, clone 53-6.7 Antibody 25 μg, Anti-CD8a (Mouse), violetFluor™ 450, clone 53-6.7 Antibody is an antibody against CD8a for use in Flow Cytometry. pricing
FCMAB427F Milli-Mark® Anti-mouse CD8-FITC Antibody, clone 3.155 100 tests, Detect mouse CD8 using this Milli-Mark Anti-mouse CD8-FITC Antibody, clone 3.155 validated for use in FC. pricing
FCMAB428PE Milli-Mark® Anti-mouse CD8-PE Antibody, clone 3.155 100 tests, Milli-Mark Anti-mouse CD8-PE Antibody, clone 3.155 is an antibody against mouse CD8 for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001768 Rosetta Predictions human pricing
NM_171827 Rosetta Predictions human pricing
NM_031538 Rosetta Predictions rat pricing
NM_001081110 Rosetta Predictions mouse pricing
NM_009857 Rosetta Predictions mouse pricing
XM_132621 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332508 predicted 433
2 SASI_Hs01_00211319 predicted 377
3 SASI_Hs02_00332509 predicted 289
4 SASI_Hs01_00211320 predicted 891
5 SASI_Hs01_00211321 predicted 860
6 SASI_Hs01_00211322 predicted 490
7 SASI_Hs01_00211323 predicted 768
8 SASI_Hs01_00211324 predicted 550
9 SASI_Hs01_00211325 predicted 866
10 SASI_Hs01_00211326 predicted 709
11 SASI_Hs01_00211327 predicted 1079
12 SASI_Hs01_00211328 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367752 predicted 440
2 SASI_Hs01_00078582 predicted 372
3 SASI_Hs02_00367753 predicted 284
4 SASI_Hs01_00078583 predicted 775
5 SASI_Hs01_00078584 predicted 755
6 SASI_Hs01_00078585 predicted 748
7 SASI_Hs01_00078586 predicted 492
8 SASI_Hs01_00078587 predicted 547
9 SASI_Hs01_00078588 predicted 754
10 SASI_Hs01_00078589 predicted 962
11 SASI_Hs01_00078590 predicted 535
12 SASI_Hs01_00078591 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093092 predicted 696
2 SASI_Rn02_00264707 predicted 1161
3 SASI_Rn01_00093093 predicted 583
4 SASI_Rn01_00093094 predicted 939
5 SASI_Rn01_00093095 predicted 253
6 SASI_Rn01_00093097 predicted 719
7 SASI_Rn01_00093099 predicted 215
8 SASI_Rn02_00264708 predicted 344
9 SASI_Rn01_00093100 predicted 245
10 SASI_Rn01_00093101 predicted 314
11 SASI_Rn01_00093096 predicted 1127
12 SASI_Rn01_00093098 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295281 predicted 431
2 SASI_Mm02_00295282 predicted 1067
3 SASI_Mm02_00295283 predicted 1192
4 SASI_Mm02_00295284 predicted 1026
5 SASI_Mm02_00295285 predicted 1131
6 SASI_Mm02_00295286 predicted 1059
7 SASI_Mm02_00295287 predicted 1290
8 SASI_Mm02_00295288 predicted 1224
9 SASI_Mm02_00295289 predicted 447
10 SASI_Mm02_00295290 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317257 predicted 427
2 SASI_Mm02_00317258 predicted 1029
3 SASI_Mm02_00317259 predicted 1161
4 SASI_Mm02_00317260 predicted 991
5 SASI_Mm02_00317261 predicted 1103
6 SASI_Mm02_00317262 predicted 1036
7 SASI_Mm02_00317263 predicted 1265
8 SASI_Mm02_00317264 predicted 1196
9 SASI_Mm02_00317265 predicted 448
10 SASI_Mm02_00317266 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285325 predicted 689
2 SASI_Mm01_00285326 predicted 439
3 SASI_Mm01_00285327 predicted 690
4 SASI_Mm01_00285328 predicted 693
5 SASI_Mm01_00285329 predicted 495
6 SASI_Mm01_00285330 predicted 519
7 SASI_Mm01_00285331 predicted 434
8 SASI_Mm01_00285332 predicted 686
9 SASI_Mm01_00285333 predicted 448
10 SASI_Mm01_00285334 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001768
CD8A MISSION shRNA Bacterial Glycerol Stock
CD8a molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001768.6-1959s21c1
Sequence:CCGGCCAGAGACAGCTTGATCAAAGCTCGAGCTTTGATCAAGCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001768.6-1691s21c1
Sequence:CCGGGTGTATTCATTCTCATGATTACTCGAGTAATCATGAGAATGAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001768.6-1417s21c1
Sequence:CCGGGCTGGACTTCGCCTGTGATATCTCGAGATATCACAGGCGAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-704s1c1
Sequence:CCGGCCTTCTCCTGTCACTGGTTATCTCGAGATAACCAGTGACAGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-728s1c1
Sequence:CCGGCCTTTACTGCAACCACAGGAACTCGAGTTCCTGTGGTTGCAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-325s1c1
Sequence:CCGGTCCTCCTATACCTCTCCCAAACTCGAGTTTGGGAGAGGTATAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-800s1c1
Sequence:CCGGGCCCAGCCTTTCGGCGAGATACTCGAGTATCTCGCCGAAAGGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-779s1c1
Sequence:CCGGTGTGGTCAAATCGGGAGACAACTCGAGTTGTCTCCCGATTTGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001768
CD8A MISSION shRNA shRNA Plasmid DNA
CD8a molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001768.6-1959s21c1
Sequence:CCGGCCAGAGACAGCTTGATCAAAGCTCGAGCTTTGATCAAGCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001768.6-1691s21c1
Sequence:CCGGGTGTATTCATTCTCATGATTACTCGAGTAATCATGAGAATGAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001768.6-1417s21c1
Sequence:CCGGGCTGGACTTCGCCTGTGATATCTCGAGATATCACAGGCGAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-704s1c1
Sequence:CCGGCCTTCTCCTGTCACTGGTTATCTCGAGATAACCAGTGACAGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-728s1c1
Sequence:CCGGCCTTTACTGCAACCACAGGAACTCGAGTTCCTGTGGTTGCAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-325s1c1
Sequence:CCGGTCCTCCTATACCTCTCCCAAACTCGAGTTTGGGAGAGGTATAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-800s1c1
Sequence:CCGGGCCCAGCCTTTCGGCGAGATACTCGAGTATCTCGCCGAAAGGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-779s1c1
Sequence:CCGGTGTGGTCAAATCGGGAGACAACTCGAGTTGTCTCCCGATTTGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001768
CD8A MISSION shRNA Lentiviral Transduction Particles
CD8a molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001768.6-1959s21c1
Sequence:CCGGCCAGAGACAGCTTGATCAAAGCTCGAGCTTTGATCAAGCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001768.6-1691s21c1
Sequence:CCGGGTGTATTCATTCTCATGATTACTCGAGTAATCATGAGAATGAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001768.6-1417s21c1
Sequence:CCGGGCTGGACTTCGCCTGTGATATCTCGAGATATCACAGGCGAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-704s1c1
Sequence:CCGGCCTTCTCCTGTCACTGGTTATCTCGAGATAACCAGTGACAGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-728s1c1
Sequence:CCGGCCTTTACTGCAACCACAGGAACTCGAGTTCCTGTGGTTGCAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-325s1c1
Sequence:CCGGTCCTCCTATACCTCTCCCAAACTCGAGTTTGGGAGAGGTATAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-800s1c1
Sequence:CCGGGCCCAGCCTTTCGGCGAGATACTCGAGTATCTCGCCGAAAGGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001768.4-779s1c1
Sequence:CCGGTGTGGTCAAATCGGGAGACAACTCGAGTTGTCTCCCGATTTGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132621
CD8A MISSION shRNA Bacterial Glycerol Stock
CD8a molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132621.5-1451s1c1
Sequence:CCGGCCCTTGTAAGAACTGGGAAATCTCGAGATTTCCCAGTTCTTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132621.5-445s1c1
Sequence:CCGGGACACGAATAATAAGTACGTTCTCGAGAACGTACTTATTATTCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132621.5-411s1c1
Sequence:CCGGGCTGAATTCGTCGAAACTGTTCTCGAGAACAGTTTCGACGAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132621.5-217s1c1
Sequence:CCGGGCACCCGAACTCCGAATCTTTCTCGAGAAAGATTCGGAGTTCGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132621.5-359s1c1
Sequence:CCGGCCTTCGTTGTCTATATGGCTTCTCGAGAAGCCATATAGACAACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132621
CD8A MISSION shRNA shRNA Plasmid DNA
CD8a molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132621.5-1451s1c1
Sequence:CCGGCCCTTGTAAGAACTGGGAAATCTCGAGATTTCCCAGTTCTTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132621.5-445s1c1
Sequence:CCGGGACACGAATAATAAGTACGTTCTCGAGAACGTACTTATTATTCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132621.5-411s1c1
Sequence:CCGGGCTGAATTCGTCGAAACTGTTCTCGAGAACAGTTTCGACGAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132621.5-217s1c1
Sequence:CCGGGCACCCGAACTCCGAATCTTTCTCGAGAAAGATTCGGAGTTCGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132621.5-359s1c1
Sequence:CCGGCCTTCGTTGTCTATATGGCTTCTCGAGAAGCCATATAGACAACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132621
CD8A MISSION shRNA Lentiviral Transduction Particles
CD8a molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132621.5-1451s1c1
Sequence:CCGGCCCTTGTAAGAACTGGGAAATCTCGAGATTTCCCAGTTCTTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132621.5-445s1c1
Sequence:CCGGGACACGAATAATAAGTACGTTCTCGAGAACGTACTTATTATTCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132621.5-411s1c1
Sequence:CCGGGCTGAATTCGTCGAAACTGTTCTCGAGAACAGTTTCGACGAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132621.5-217s1c1
Sequence:CCGGGCACCCGAACTCCGAATCTTTCTCGAGAAAGATTCGGAGTTCGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132621.5-359s1c1
Sequence:CCGGCCTTCGTTGTCTATATGGCTTCTCGAGAAGCCATATAGACAACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks