EMAIL THIS PAGE TO A FRIEND

CD8B

CD8b molecule

149 Gene Product Result for
Synonyms: CD8B1 LEU2 LY3 LYT3 P37
Gene ID:
Human(926) Summary: The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified. [provided by RefSeq, May 2010]
Rat(24931) CD8b molecule
sheep(101103712) CD8b molecule
chicken(396175) CD8b molecule
dog(483076) CD8b molecule
cow(508633) CD8b molecule
domestic cat(493948) CD8b molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405578 Anti-CD8B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV42204 Anti-CD8B antibody produced in rabbit affinity isolated antibody guinea pig, human, canine, horse
western blot pricing
SAB2105456 Anti-CD8B antibody produced in rabbit affinity isolated antibody human, rabbit
western blot pricing
HPA029164 Anti-CD8B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1305714 ANTI-CD8B1(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
C7423 Monoclonal Anti-CD8 antibody produced in mouse clone UCHT-4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
F0772 Monoclonal Anti-CD8−FITC antibody produced in mouse clone UCHT-4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
P5560 Monoclonal Anti-CD8−PE antibody produced in mouse clone UCHT-4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
R6260 Monoclonal Anti-CD8−Quantum Red antibody produced in mouse clone UCHT-4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700738 Monoclonal Anti-CD8b antibody produced in mouse clone 341, purified immunoglobulin, buffered aqueous solution rat
flow cytometry, FUNC, immunohistochemistry, immunoprecipitation, western blot pricing
WH0000926M7 Monoclonal Anti-CD8B1 antibody produced in mouse clone 4C8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004931 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148081 MISSION® esiRNA esiRNA human CD8B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004931 Rosetta Predictions human pricing
NM_172099 Rosetta Predictions human pricing
NM_172101 Rosetta Predictions human pricing
NM_172102 Rosetta Predictions human pricing
NM_172213 Rosetta Predictions human pricing
NM_031539 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186175 predicted 252
2 SASI_Hs01_00186176 predicted 235
3 SASI_Hs01_00186177 predicted 252
4 SASI_Hs02_00338596 predicted 306
5 SASI_Hs01_00186178 predicted 237
6 SASI_Hs02_00338597 predicted 308
7 SASI_Hs01_00186179 predicted 225
8 SASI_Hs02_00338598 predicted 311
9 SASI_Hs01_00186181 predicted 260
10 SASI_Hs01_00186182 predicted 229
11 SASI_Hs01_00186180 predicted 220
12 SASI_Hs01_00186183 predicted 283
13 SASI_Hs01_00186184 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119046 predicted 258
2 SASI_Hs01_00119047 predicted 226
3 SASI_Hs01_00119048 predicted 258
4 SASI_Hs01_00119049 predicted 297
5 SASI_Hs01_00119050 predicted 233
6 SASI_Hs01_00119051 predicted 314
7 SASI_Hs01_00119052 predicted 220
8 SASI_Hs01_00119053 predicted 309
9 SASI_Hs01_00119054 predicted 259
10 SASI_Hs01_00119055 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088474 predicted 256
2 SASI_Hs01_00088475 predicted 232
3 SASI_Hs01_00088476 predicted 259
4 SASI_Hs02_00367820 predicted 299
5 SASI_Hs01_00088477 predicted 233
6 SASI_Hs02_00367821 predicted 312
7 SASI_Hs01_00088478 predicted 217
8 SASI_Hs02_00367822 predicted 315
9 SASI_Hs01_00088480 predicted 261
10 SASI_Hs01_00088481 predicted 233
11 SASI_Hs01_00088479 predicted 216
12 SASI_Hs01_00088482 predicted 279
13 SASI_Hs01_00088483 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123369 predicted 254
2 SASI_Hs01_00123370 predicted 227
3 SASI_Hs01_00123371 predicted 256
4 SASI_Hs02_00367823 predicted 306
5 SASI_Hs01_00123372 predicted 237
6 SASI_Hs02_00367824 predicted 312
7 SASI_Hs01_00123373 predicted 222
8 SASI_Hs02_00367825 predicted 309
9 SASI_Hs01_00123375 predicted 255
10 SASI_Hs01_00123376 predicted 228
11 SASI_Hs01_00123374 predicted 225
12 SASI_Hs01_00123377 predicted 286
13 SASI_Hs01_00123378 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234081 predicted 256
2 SASI_Hs01_00234082 predicted 232
3 SASI_Hs01_00234083 predicted 251
4 SASI_Hs02_00367917 predicted 298
5 SASI_Hs01_00234084 predicted 230
6 SASI_Hs02_00367918 predicted 308
7 SASI_Hs01_00234085 predicted 225
8 SASI_Hs02_00367919 predicted 310
9 SASI_Hs01_00234087 predicted 258
10 SASI_Hs01_00234088 predicted 233
11 SASI_Hs01_00234086 predicted 218
12 SASI_Hs01_00234089 predicted 283
13 SASI_Hs01_00234090 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046268 predicted 254
2 SASI_Rn01_00046270 predicted 523
3 SASI_Rn01_00046271 predicted 689
4 SASI_Rn01_00046272 predicted 631
5 SASI_Rn02_00264709 predicted 505
6 SASI_Rn01_00046273 predicted 600
7 SASI_Rn02_00264710 predicted 262
8 SASI_Rn01_00046275 predicted 368
9 SASI_Rn01_00046276 predicted 938
10 SASI_Rn01_00046277 predicted 854
11 SASI_Rn01_00046269 predicted 738
12 SASI_Rn01_00046274 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004931
CD8B MISSION shRNA Bacterial Glycerol Stock
CD8b molecule
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004931.2-924s1c1
Sequence:CCGGGCTGGAGGACTGAGTAAGAAACTCGAGTTTCTTACTCAGTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004931.2-653s1c1
Sequence:CCGGGCTTCGTTTCATGAAACAATTCTCGAGAATTGTTTCATGAAACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004931.2-126s1c1
Sequence:CCGGCCTGCATACATAAAGGTGCAACTCGAGTTGCACCTTTATGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004931.2-336s1c1
Sequence:CCGGGCAAGCCGGTTCATTCTCAATCTCGAGATTGAGAATGAACCGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004931.2-188s1c1
Sequence:CCGGCCTCAGTAACATGCGCATCTACTCGAGTAGATGCGCATGTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004931.3-440s21c1
Sequence:CCGGTCAGCTGAGTGTGGTTGATTTCTCGAGAAATCAACCACACTCAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004931.3-1040s21c1
Sequence:CCGGCCTGGTAGGGCAGTAACATTGCTCGAGCAATGTTACTGCCCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004931
CD8B MISSION shRNA shRNA Plasmid DNA
CD8b molecule
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004931.2-924s1c1
Sequence:CCGGGCTGGAGGACTGAGTAAGAAACTCGAGTTTCTTACTCAGTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004931.2-653s1c1
Sequence:CCGGGCTTCGTTTCATGAAACAATTCTCGAGAATTGTTTCATGAAACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004931.2-126s1c1
Sequence:CCGGCCTGCATACATAAAGGTGCAACTCGAGTTGCACCTTTATGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004931.2-336s1c1
Sequence:CCGGGCAAGCCGGTTCATTCTCAATCTCGAGATTGAGAATGAACCGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004931.2-188s1c1
Sequence:CCGGCCTCAGTAACATGCGCATCTACTCGAGTAGATGCGCATGTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004931.3-440s21c1
Sequence:CCGGTCAGCTGAGTGTGGTTGATTTCTCGAGAAATCAACCACACTCAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004931.3-1040s21c1
Sequence:CCGGCCTGGTAGGGCAGTAACATTGCTCGAGCAATGTTACTGCCCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004931
CD8B MISSION shRNA Lentiviral Transduction Particles
CD8b molecule
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004931.2-924s1c1
Sequence:CCGGGCTGGAGGACTGAGTAAGAAACTCGAGTTTCTTACTCAGTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004931.2-653s1c1
Sequence:CCGGGCTTCGTTTCATGAAACAATTCTCGAGAATTGTTTCATGAAACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004931.2-126s1c1
Sequence:CCGGCCTGCATACATAAAGGTGCAACTCGAGTTGCACCTTTATGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004931.2-336s1c1
Sequence:CCGGGCAAGCCGGTTCATTCTCAATCTCGAGATTGAGAATGAACCGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004931.2-188s1c1
Sequence:CCGGCCTCAGTAACATGCGCATCTACTCGAGTAGATGCGCATGTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004931.3-440s21c1
Sequence:CCGGTCAGCTGAGTGTGGTTGATTTCTCGAGAAATCAACCACACTCAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004931.3-1040s21c1
Sequence:CCGGCCTGGTAGGGCAGTAACATTGCTCGAGCAATGTTACTGCCCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks