EMAIL THIS PAGE TO A FRIEND

CD93

CD93 molecule

79 Gene Product Result for
Synonyms: C1QR1 C1qR(P) C1qRP CDw93 ECSM3 MXRA4 dJ737E23.1
UniProtKB ID: Q9NPY3, O00274
Gene ID:
Human(22918) Summary: The protein encoded by this gene is a cell-surface glycoprotein and type I membrane protein that was originally identified as a myeloid cell-specific marker. The encoded protein was once thought to be a receptor for C1q, but now is thought to instead be involved in intercellular adhesion and in the clearance of apoptotic cells. The intracellular cytoplasmic tail of this protein has been found to interact with moesin, a protein known to play a role in linking transmembrane proteins to the cytoskeleton and in the remodelling of the cytoskeleton. [provided by RefSeq, Jul 2008]
Mouse(17064) CD93 antigen
Rat(84398) CD93 molecule
sheep(100302099) CD93 molecule
chicken(421234) CD93 molecule
cow(539690) CD93 molecule
Horse(100059201) CD93 molecule
domestic cat(101086798) CD93 molecule
dog(606923) CD93 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012072 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023791 MISSION® esiRNA esiRNA human CD93 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012072 Rosetta Predictions human pricing
NM_053383 Rosetta Predictions rat pricing
NM_010740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010511 predicted 2329
2 SASI_Hs02_00343544 predicted 451
3 SASI_Hs01_00010513 predicted 530
4 SASI_Hs01_00010514 predicted 1012
5 SASI_Hs01_00010515 predicted 833
6 SASI_Hs01_00010518 predicted 428
7 SASI_Hs02_00343545 predicted 507
8 SASI_Hs01_00010519 predicted 2585
9 SASI_Hs01_00010520 predicted 507
10 SASI_Hs02_00343546 predicted 825
11 SASI_Hs01_00010512 predicted 799
12 SASI_Hs01_00010516 predicted 2477
13 SASI_Hs01_00010517 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108246 predicted 2044
2 SASI_Rn01_00108247 predicted 2027
3 SASI_Rn01_00108248 predicted 1412
4 SASI_Rn01_00108249 predicted 876
5 SASI_Rn01_00108250 predicted 1387
6 SASI_Rn01_00108251 predicted 1476
7 SASI_Rn01_00108252 predicted 503
8 SASI_Rn01_00108253 predicted 1803
9 SASI_Rn01_00108254 predicted 1190
10 SASI_Rn02_00265881 predicted 550
11 SASI_Rn01_00108255 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095060 predicted 962
2 SASI_Mm01_00095061 predicted 1197
3 SASI_Mm01_00095062 predicted 620
4 SASI_Mm02_00319240 predicted 1568
5 SASI_Mm01_00095064 predicted 2109
6 SASI_Mm01_00095065 predicted 277
7 SASI_Mm01_00095066 predicted 1409
8 SASI_Mm01_00095067 predicted 1949
9 SASI_Mm01_00095068 predicted 787
10 SASI_Mm01_00095069 predicted 805
11 SASI_Mm01_00095063 predicted 1788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012072
CD93 MISSION shRNA Bacterial Glycerol Stock
CD93 molecule
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012072.3-2252s21c1
Sequence:CCGGCCTTGGAACATGCAGGTATTTCTCGAGAAATACCTGCATGTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-661s1c1
Sequence:CCGGCGGAAGTAACATTGAGGGCTTCTCGAGAAGCCCTCAATGTTACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-2021s1c1
Sequence:CCGGGCAGACAGTTACTCCTGGGTTCTCGAGAACCCAGGAGTAACTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-682s1c1
Sequence:CCGGCGTGTGCAAGTTCAGCTTCAACTCGAGTTGAAGCTGAACTTGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-841s1c1
Sequence:CCGGCGAGACTCAGAGTCATTATTTCTCGAGAAATAATGACTCTGAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-517s1c1
Sequence:CCGGGCCTTACTCTAACTGGCACAACTCGAGTTGTGCCAGTTAGAGTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012072
CD93 MISSION shRNA shRNA Plasmid DNA
CD93 molecule
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012072.3-2252s21c1
Sequence:CCGGCCTTGGAACATGCAGGTATTTCTCGAGAAATACCTGCATGTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-661s1c1
Sequence:CCGGCGGAAGTAACATTGAGGGCTTCTCGAGAAGCCCTCAATGTTACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-2021s1c1
Sequence:CCGGGCAGACAGTTACTCCTGGGTTCTCGAGAACCCAGGAGTAACTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-682s1c1
Sequence:CCGGCGTGTGCAAGTTCAGCTTCAACTCGAGTTGAAGCTGAACTTGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-841s1c1
Sequence:CCGGCGAGACTCAGAGTCATTATTTCTCGAGAAATAATGACTCTGAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-517s1c1
Sequence:CCGGGCCTTACTCTAACTGGCACAACTCGAGTTGTGCCAGTTAGAGTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012072
CD93 MISSION shRNA Lentiviral Transduction Particles
CD93 molecule
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012072.3-2252s21c1
Sequence:CCGGCCTTGGAACATGCAGGTATTTCTCGAGAAATACCTGCATGTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-661s1c1
Sequence:CCGGCGGAAGTAACATTGAGGGCTTCTCGAGAAGCCCTCAATGTTACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-2021s1c1
Sequence:CCGGGCAGACAGTTACTCCTGGGTTCTCGAGAACCCAGGAGTAACTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-682s1c1
Sequence:CCGGCGTGTGCAAGTTCAGCTTCAACTCGAGTTGAAGCTGAACTTGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-841s1c1
Sequence:CCGGCGAGACTCAGAGTCATTATTTCTCGAGAAATAATGACTCTGAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012072.2-517s1c1
Sequence:CCGGGCCTTACTCTAACTGGCACAACTCGAGTTGTGCCAGTTAGAGTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010740
CD93 MISSION shRNA Bacterial Glycerol Stock
CD93 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010740.1-1781s1c1
Sequence:CCGGGCAAGCCGACACATGAAGATTCTCGAGAATCTTCATGTGTCGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010740.1-1338s1c1
Sequence:CCGGCTCCTGTAAAGAGGGCTATATCTCGAGATATAGCCCTCTTTACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010740.1-487s1c1
Sequence:CCGGGCTTATTCAAACTGGTACAAACTCGAGTTTGTACCAGTTTGAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010740.1-625s1c1
Sequence:CCGGGCTCCAGGTAACAGCATTGAACTCGAGTTCAATGCTGTTACCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010740.1-2799s1c1
Sequence:CCGGGCCCTCAGTAAGAACATAAATCTCGAGATTTATGTTCTTACTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010740
CD93 MISSION shRNA shRNA Plasmid DNA
CD93 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010740.1-1781s1c1
Sequence:CCGGGCAAGCCGACACATGAAGATTCTCGAGAATCTTCATGTGTCGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010740.1-1338s1c1
Sequence:CCGGCTCCTGTAAAGAGGGCTATATCTCGAGATATAGCCCTCTTTACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010740.1-487s1c1
Sequence:CCGGGCTTATTCAAACTGGTACAAACTCGAGTTTGTACCAGTTTGAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010740.1-625s1c1
Sequence:CCGGGCTCCAGGTAACAGCATTGAACTCGAGTTCAATGCTGTTACCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010740.1-2799s1c1
Sequence:CCGGGCCCTCAGTAAGAACATAAATCTCGAGATTTATGTTCTTACTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010740
CD93 MISSION shRNA Lentiviral Transduction Particles
CD93 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010740.1-1781s1c1
Sequence:CCGGGCAAGCCGACACATGAAGATTCTCGAGAATCTTCATGTGTCGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010740.1-1338s1c1
Sequence:CCGGCTCCTGTAAAGAGGGCTATATCTCGAGATATAGCCCTCTTTACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010740.1-487s1c1
Sequence:CCGGGCTTATTCAAACTGGTACAAACTCGAGTTTGTACCAGTTTGAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010740.1-625s1c1
Sequence:CCGGGCTCCAGGTAACAGCATTGAACTCGAGTTCAATGCTGTTACCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010740.1-2799s1c1
Sequence:CCGGGCCCTCAGTAAGAACATAAATCTCGAGATTTATGTTCTTACTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks