EMAIL THIS PAGE TO A FRIEND

CD96

CD96 molecule

121 Gene Product Result for
Synonyms: TACTILE
UniProtKB ID: P40200, Q5JPB3
Gene ID:
Human(10225) Summary: The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein. The protein may play a role in the adhesive interactions of activated T and NK cells during the late phase of the immune response. It may also function in antigen presentation. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(84544) CD96 antigen
Rat(498079) CD96 molecule
dog(487972) CD96 molecule
cow(509578) CD96 molecule
Horse(100061586) CD96 molecule
domestic cat(101085566) CD96 molecule
sheep(101117717) CD96 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005816 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005816 Rosetta Predictions human pricing
NM_198196 Rosetta Predictions human pricing
NM_001025032 Rosetta Predictions rat pricing
NM_032465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020183 predicted 1686
2 SASI_Hs01_00020185 predicted 974
3 SASI_Hs01_00020186 predicted 1430
4 SASI_Hs01_00020187 predicted 1836
5 SASI_Hs01_00020188 predicted 1664
6 SASI_Hs01_00020189 predicted 1836
7 SASI_Hs01_00020190 predicted 1330
8 SASI_Hs02_00340341 predicted 431
9 SASI_Hs01_00020191 predicted 1176
10 SASI_Hs02_00340342 predicted 478
11 SASI_Hs01_00020182 predicted 438
12 SASI_Hs01_00020184 predicted 1719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113498 predicted 1729
2 SASI_Hs01_00113500 predicted 1015
3 SASI_Hs01_00113501 predicted 1473
4 SASI_Hs01_00113502 predicted 1888
5 SASI_Hs01_00113503 predicted 1720
6 SASI_Hs01_00113504 predicted 1885
7 SASI_Hs01_00113505 predicted 1382
8 SASI_Hs02_00371735 predicted 422
9 SASI_Hs01_00113506 predicted 1218
10 SASI_Hs02_00371736 predicted 479
11 SASI_Hs01_00113497 predicted 447
12 SASI_Hs01_00113499 predicted 1772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063195 predicted 1187
2 SASI_Rn01_00063196 predicted 1773
3 SASI_Rn01_00063197 predicted 871
4 SASI_Rn01_00063198 predicted 907
5 SASI_Rn01_00063199 predicted 1284
6 SASI_Rn02_00202944 predicted 685
7 SASI_Rn01_00063200 predicted 812
8 SASI_Rn01_00063201 predicted 428
9 SASI_Rn02_00202945 predicted 974
10 SASI_Rn01_00063203 predicted 1215
11 SASI_Rn01_00063202 predicted 1009
12 SASI_Rn01_00063204 predicted 1509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115268 predicted 1714
2 SASI_Mm01_00115269 predicted 1624
3 SASI_Mm01_00115270 predicted 1892
4 SASI_Mm01_00115271 predicted 942
5 SASI_Mm01_00115273 predicted 549
6 SASI_Mm01_00115274 predicted 1407
7 SASI_Mm01_00115276 predicted 598
8 SASI_Mm01_00115277 predicted 570
9 SASI_Mm02_00337250 predicted 577
10 SASI_Mm02_00337251 predicted 347
11 SASI_Mm01_00115272 predicted 1593
12 SASI_Mm01_00115275 predicted 1128
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032465
CD96 MISSION shRNA Bacterial Glycerol Stock
CD96 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032465.1-929s1c1
Sequence:CCGGGAAGAATTGCAGTAGCGGATTCTCGAGAATCCGCTACTGCAATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032465.1-1752s1c1
Sequence:CCGGCCCATCAAGTACACGTATATTCTCGAGAATATACGTGTACTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032465.1-1859s1c1
Sequence:CCGGGTCCTGTAGGAAGGGAGATATCTCGAGATATCTCCCTTCCTACAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032465.1-596s1c1
Sequence:CCGGCGTCAACAATTCCACATCATTCTCGAGAATGATGTGGAATTGTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032465.1-865s1c1
Sequence:CCGGCCTGGTTTATAGACGGAAGATCTCGAGATCTTCCGTCTATAAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032465
CD96 MISSION shRNA shRNA Plasmid DNA
CD96 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032465.1-929s1c1
Sequence:CCGGGAAGAATTGCAGTAGCGGATTCTCGAGAATCCGCTACTGCAATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032465.1-1752s1c1
Sequence:CCGGCCCATCAAGTACACGTATATTCTCGAGAATATACGTGTACTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032465.1-1859s1c1
Sequence:CCGGGTCCTGTAGGAAGGGAGATATCTCGAGATATCTCCCTTCCTACAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032465.1-596s1c1
Sequence:CCGGCGTCAACAATTCCACATCATTCTCGAGAATGATGTGGAATTGTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032465.1-865s1c1
Sequence:CCGGCCTGGTTTATAGACGGAAGATCTCGAGATCTTCCGTCTATAAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032465
CD96 MISSION shRNA Lentiviral Transduction Particles
CD96 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032465.1-929s1c1
Sequence:CCGGGAAGAATTGCAGTAGCGGATTCTCGAGAATCCGCTACTGCAATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032465.1-1752s1c1
Sequence:CCGGCCCATCAAGTACACGTATATTCTCGAGAATATACGTGTACTTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032465.1-1859s1c1
Sequence:CCGGGTCCTGTAGGAAGGGAGATATCTCGAGATATCTCCCTTCCTACAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032465.1-596s1c1
Sequence:CCGGCGTCAACAATTCCACATCATTCTCGAGAATGATGTGGAATTGTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032465.1-865s1c1
Sequence:CCGGCCTGGTTTATAGACGGAAGATCTCGAGATCTTCCGTCTATAAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005816
CD96 MISSION shRNA Bacterial Glycerol Stock
CD96 molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005816.3-1907s1c1
Sequence:CCGGCCAACGAAAGTGATCTGCCTTCTCGAGAAGGCAGATCACTTTCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005816.3-491s1c1
Sequence:CCGGCCTGTGAGTCACTTGTGACTTCTCGAGAAGTCACAAGTGACTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005816.3-1756s1c1
Sequence:CCGGCCAGTGATTGTAGCAGCTTTACTCGAGTAAAGCTGCTACAATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005816.3-1275s1c1
Sequence:CCGGCCCAGGAAATAAAGTGTGGAACTCGAGTTCCACACTTTATTTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005816.4-507s21c1
Sequence:CCGGAGTGGAAGGTACGAGTGTATGCTCGAGCATACACTCGTACCTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005816.4-761s21c1
Sequence:GTACCGGCAGCAATTCCACATTACTTAACTCGAGTTAAGTAATGTGGAATTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005816.4-4254s21c1
Sequence:GTACCGGACATAGCGACAGATAACTATACTCGAGTATAGTTATCTGTCGCTATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005816.4-4004s21c1
Sequence:GTACCGGTGTCAAGGAACTAAGGTATTTCTCGAGAAATACCTTAGTTCCTTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005816.4-1633s21c1
Sequence:CCGGACGTCCATATCACTGGTATTGCTCGAGCAATACCAGTGATATGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005816
CD96 MISSION shRNA shRNA Plasmid DNA
CD96 molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005816.3-1907s1c1
Sequence:CCGGCCAACGAAAGTGATCTGCCTTCTCGAGAAGGCAGATCACTTTCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005816.3-491s1c1
Sequence:CCGGCCTGTGAGTCACTTGTGACTTCTCGAGAAGTCACAAGTGACTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005816.3-1756s1c1
Sequence:CCGGCCAGTGATTGTAGCAGCTTTACTCGAGTAAAGCTGCTACAATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005816.3-1275s1c1
Sequence:CCGGCCCAGGAAATAAAGTGTGGAACTCGAGTTCCACACTTTATTTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005816.4-507s21c1
Sequence:CCGGAGTGGAAGGTACGAGTGTATGCTCGAGCATACACTCGTACCTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005816.4-761s21c1
Sequence:GTACCGGCAGCAATTCCACATTACTTAACTCGAGTTAAGTAATGTGGAATTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005816.4-4254s21c1
Sequence:GTACCGGACATAGCGACAGATAACTATACTCGAGTATAGTTATCTGTCGCTATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005816.4-4004s21c1
Sequence:GTACCGGTGTCAAGGAACTAAGGTATTTCTCGAGAAATACCTTAGTTCCTTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005816.4-1633s21c1
Sequence:CCGGACGTCCATATCACTGGTATTGCTCGAGCAATACCAGTGATATGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005816
CD96 MISSION shRNA Lentiviral Transduction Particles
CD96 molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005816.3-1907s1c1
Sequence:CCGGCCAACGAAAGTGATCTGCCTTCTCGAGAAGGCAGATCACTTTCGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005816.3-491s1c1
Sequence:CCGGCCTGTGAGTCACTTGTGACTTCTCGAGAAGTCACAAGTGACTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005816.3-1756s1c1
Sequence:CCGGCCAGTGATTGTAGCAGCTTTACTCGAGTAAAGCTGCTACAATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005816.3-1275s1c1
Sequence:CCGGCCCAGGAAATAAAGTGTGGAACTCGAGTTCCACACTTTATTTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005816.4-507s21c1
Sequence:CCGGAGTGGAAGGTACGAGTGTATGCTCGAGCATACACTCGTACCTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005816.4-761s21c1
Sequence:GTACCGGCAGCAATTCCACATTACTTAACTCGAGTTAAGTAATGTGGAATTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005816.4-4254s21c1
Sequence:GTACCGGACATAGCGACAGATAACTATACTCGAGTATAGTTATCTGTCGCTATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005816.4-4004s21c1
Sequence:GTACCGGTGTCAAGGAACTAAGGTATTTCTCGAGAAATACCTTAGTTCCTTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005816.4-1633s21c1
Sequence:CCGGACGTCCATATCACTGGTATTGCTCGAGCAATACCAGTGATATGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)