EMAIL THIS PAGE TO A FRIEND

CD97

CD97 molecule

93 Gene Product Result for
Synonyms: TM7LN1
Gene ID:
Human(976) Summary: This gene encodes a member of the EGF-TM7 subfamily of adhesion G protein-coupled receptors, which mediate cell-cell interactions. These proteins are cleaved by self-catalytic proteolysis into a large extracellular subunit and seven-span transmembrane subunit, which associate at the cell surface as a receptor complex. The encoded protein may play a role in cell adhesion as well as leukocyte recruitment, activation and migration, and contains multiple extracellular EGF-like repeats which mediate binding to chondroitin sulfate and the cell surface complement regulatory protein CD55. Expression of this gene may play a role in the progression of several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms with 3 to 5 EGF-like repeats have been observed for this gene. This gene is found in a cluster with other EGF-TM7 genes on the short arm of chromosome 19. [provided by RefSeq, Jun 2011]
Mouse(26364) CD97 antigen
Rat(361383) CD97 molecule
sheep(101122596) CD97 molecule
dog(484904) CD97 molecule
cow(338066) CD97 molecule
domestic cat(101097302) CD97 molecule
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0638 Human CD97 / CD97 Antigen ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_078481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_078481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_078481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061981 MISSION® esiRNA esiRNA human CD97 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025160 Rosetta Predictions human pricing
NM_001784 Rosetta Predictions human pricing
NM_078481 Rosetta Predictions human pricing
NM_001012164 Rosetta Predictions rat pricing
XM_574215 Rosetta Predictions rat pricing
NM_011925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209256 predicted 1084
2 SASI_Hs01_00209257 predicted 2617
3 SASI_Hs01_00209258 predicted 964
4 SASI_Hs01_00209259 predicted 1575
5 SASI_Hs02_00307385 predicted 2343
6 SASI_Hs01_00209260 predicted 2468
7 SASI_Hs01_00209261 predicted 2401
8 SASI_Hs01_00209262 predicted 1922
9 SASI_Hs01_00209265 predicted 2012
10 SASI_Hs02_00307386 predicted 2145
11 SASI_Hs01_00209263 predicted 2238
12 SASI_Hs01_00209264 predicted 2629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144027 predicted 957
2 SASI_Hs01_00144028 predicted 2483
3 SASI_Hs01_00144029 predicted 833
4 SASI_Hs01_00144030 predicted 1444
5 SASI_Hs02_00332544 predicted 2206
6 SASI_Hs01_00144031 predicted 2345
7 SASI_Hs01_00144032 predicted 2270
8 SASI_Hs01_00144033 predicted 1786
9 SASI_Hs01_00144036 predicted 1887
10 SASI_Hs02_00332545 predicted 2009
11 SASI_Hs01_00144034 predicted 2099
12 SASI_Hs01_00144035 predicted 2497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134340 predicted 1230
2 SASI_Hs01_00134341 predicted 2771
3 SASI_Hs01_00134342 predicted 1107
4 SASI_Hs01_00134343 predicted 1724
5 SASI_Hs02_00362168 predicted 2492
6 SASI_Hs01_00134344 predicted 2624
7 SASI_Hs01_00134345 predicted 2553
8 SASI_Hs01_00134346 predicted 2062
9 SASI_Hs01_00134349 predicted 2160
10 SASI_Hs02_00362169 predicted 2286
11 SASI_Hs01_00134347 predicted 2386
12 SASI_Hs01_00134348 predicted 2771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107121 predicted 295
2 SASI_Rn01_00107122 predicted 2163
3 SASI_Rn01_00107124 predicted 815
4 SASI_Rn01_00107125 predicted 801
5 SASI_Rn01_00107126 predicted 1481
6 SASI_Rn02_00200359 predicted 624
7 SASI_Rn01_00107127 predicted 2188
8 SASI_Rn01_00107128 predicted 773
9 SASI_Rn01_00107129 predicted 657
10 SASI_Rn01_00107130 predicted 543
11 SASI_Rn01_00107123 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171668 predicted 1856
2 SASI_Rn01_00171669 predicted 1394
3 SASI_Rn01_00171670 predicted 1369
4 SASI_Rn01_00171671 predicted 1847
5 SASI_Rn01_00171672 predicted 1213
6 SASI_Rn01_00171673 predicted 1194
7 SASI_Rn01_00171674 predicted 1877
8 SASI_Rn01_00171675 predicted 1030
9 SASI_Rn01_00171676 predicted 1174
10 SASI_Rn01_00171677 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045904 predicted 272
2 SASI_Mm01_00045905 predicted 1342
3 SASI_Mm01_00045906 predicted 2147
4 SASI_Mm01_00045907 predicted 1129
5 SASI_Mm01_00045908 predicted 375
6 SASI_Mm01_00045909 predicted 1461
7 SASI_Mm01_00045910 predicted 2312
8 SASI_Mm01_00045911 predicted 1523
9 SASI_Mm01_00045912 predicted 1310
10 SASI_Mm01_00045913 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_078481
VALIDATED
CD97 MISSION shRNA Bacterial Glycerol Stock
CD97 molecule
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078481.2-1333s21c1
Sequence:CCGGATCCAGAACATGACGACATTGCTCGAGCAATGTCGTCATGTTCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078481.2-1393s21c1
Sequence:CCGGGCCGAACTGGAGGAGATATATCTCGAGATATATCTCCTCCAGTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_078481.2-2168s21c1
Sequence:CCGGGATACTGCTGGTTGGACTTTGCTCGAGCAAAGTCCAACCAGCAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078481.2-1013s21c1
Sequence:CCGGCCATCCAGAATGTCATCAAATCTCGAGATTTGATGACATTCTGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_078481.2-1724s21c1
Sequence:CCGGCGATCCTTATGGCTCATTATGCTCGAGCATAATGAGCCATAAGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_078481.1-2977s1c1
Sequence:CCGGCCCTCTTAAGCTAAGACTGATCTCGAGATCAGTCTTAGCTTAAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_078481.1-1670s1c1
Sequence:CCGGGCGATCCTTATGGCTCATTATCTCGAGATAATGAGCCATAAGGATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078481.1-2368s1c1
Sequence:CCGGGCTGACCTATGTGTTTACCATCTCGAGATGGTAAACACATAGGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078481.1-674s1c1
Sequence:CCGGCCAAACAATACCGTCTGTGAACTCGAGTTCACAGACGGTATTGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_078481.1-1060s1c1
Sequence:CCGGGCTCTCAAACCTTGAAGATATCTCGAGATATCTTCAAGGTTTGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_078481
VALIDATED
CD97 MISSION shRNA shRNA Plasmid DNA
CD97 molecule
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078481.2-1333s21c1
Sequence:CCGGATCCAGAACATGACGACATTGCTCGAGCAATGTCGTCATGTTCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078481.2-1393s21c1
Sequence:CCGGGCCGAACTGGAGGAGATATATCTCGAGATATATCTCCTCCAGTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_078481.2-2168s21c1
Sequence:CCGGGATACTGCTGGTTGGACTTTGCTCGAGCAAAGTCCAACCAGCAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078481.2-1013s21c1
Sequence:CCGGCCATCCAGAATGTCATCAAATCTCGAGATTTGATGACATTCTGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_078481.2-1724s21c1
Sequence:CCGGCGATCCTTATGGCTCATTATGCTCGAGCATAATGAGCCATAAGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_078481.1-2977s1c1
Sequence:CCGGCCCTCTTAAGCTAAGACTGATCTCGAGATCAGTCTTAGCTTAAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_078481.1-1670s1c1
Sequence:CCGGGCGATCCTTATGGCTCATTATCTCGAGATAATGAGCCATAAGGATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078481.1-2368s1c1
Sequence:CCGGGCTGACCTATGTGTTTACCATCTCGAGATGGTAAACACATAGGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078481.1-674s1c1
Sequence:CCGGCCAAACAATACCGTCTGTGAACTCGAGTTCACAGACGGTATTGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_078481.1-1060s1c1
Sequence:CCGGGCTCTCAAACCTTGAAGATATCTCGAGATATCTTCAAGGTTTGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_078481
VALIDATED
CD97 MISSION shRNA Lentiviral Transduction Particles
CD97 molecule
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078481.2-1333s21c1
Sequence:CCGGATCCAGAACATGACGACATTGCTCGAGCAATGTCGTCATGTTCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078481.2-1393s21c1
Sequence:CCGGGCCGAACTGGAGGAGATATATCTCGAGATATATCTCCTCCAGTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_078481.2-2168s21c1
Sequence:CCGGGATACTGCTGGTTGGACTTTGCTCGAGCAAAGTCCAACCAGCAGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078481.2-1013s21c1
Sequence:CCGGCCATCCAGAATGTCATCAAATCTCGAGATTTGATGACATTCTGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_078481.2-1724s21c1
Sequence:CCGGCGATCCTTATGGCTCATTATGCTCGAGCATAATGAGCCATAAGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_078481.1-2977s1c1
Sequence:CCGGCCCTCTTAAGCTAAGACTGATCTCGAGATCAGTCTTAGCTTAAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_078481.1-1670s1c1
Sequence:CCGGGCGATCCTTATGGCTCATTATCTCGAGATAATGAGCCATAAGGATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078481.1-2368s1c1
Sequence:CCGGGCTGACCTATGTGTTTACCATCTCGAGATGGTAAACACATAGGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078481.1-674s1c1
Sequence:CCGGCCAAACAATACCGTCTGTGAACTCGAGTTCACAGACGGTATTGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_078481.1-1060s1c1
Sequence:CCGGGCTCTCAAACCTTGAAGATATCTCGAGATATCTTCAAGGTTTGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011925
VALIDATED
CD97 MISSION shRNA Bacterial Glycerol Stock
CD97 molecule
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011925.2-2152s21c1
Sequence:CCGGGGCTATGGGCATGCAACATACCTCGAGGTATGTTGCATGCCCATAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011925.2-2643s21c1
Sequence:CCGGATGAAGGACAGCAGCACATACCTCGAGGTATGTGCTGCTGTCCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011925.2-1559s21c1
Sequence:CCGGTCACGTTCAAGTTCGACTTTACTCGAGTAAAGTCGAACTTGAACGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011925.2-1473s21c1
Sequence:CCGGGATTCCGAGTGTCTCACTTAACTCGAGTTAAGTGAGACACTCGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011925.2-460s21c1
Sequence:CCGGGTCTGTAACCTGGGATATAAGCTCGAGCTTATATCCCAGGTTACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011925.1-2270s1c1
Sequence:CCGGCCATAGCACATGGCTATCCTACTCGAGTAGGATAGCCATGTGCTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011925.1-1335s1c1
Sequence:CCGGCCGAGCGTCTCACTTAAACTTCTCGAGAAGTTTAAGTGAGACGCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011925.1-1416s1c1
Sequence:CCGGGTCACGTTCAAGTTCGACTTTCTCGAGAAAGTCGAACTTGAACGTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011925.1-316s1c1
Sequence:CCGGGCGTCTGTAACCTGGGATATACTCGAGTATATCCCAGGTTACAGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011925.1-246s1c1
Sequence:CCGGGAGTGTTTACTACCTGGATTTCTCGAGAAATCCAGGTAGTAAACACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011925
VALIDATED
CD97 MISSION shRNA shRNA Plasmid DNA
CD97 molecule
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011925.2-2152s21c1
Sequence:CCGGGGCTATGGGCATGCAACATACCTCGAGGTATGTTGCATGCCCATAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011925.2-2643s21c1
Sequence:CCGGATGAAGGACAGCAGCACATACCTCGAGGTATGTGCTGCTGTCCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011925.2-1559s21c1
Sequence:CCGGTCACGTTCAAGTTCGACTTTACTCGAGTAAAGTCGAACTTGAACGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011925.2-1473s21c1
Sequence:CCGGGATTCCGAGTGTCTCACTTAACTCGAGTTAAGTGAGACACTCGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011925.2-460s21c1
Sequence:CCGGGTCTGTAACCTGGGATATAAGCTCGAGCTTATATCCCAGGTTACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011925.1-2270s1c1
Sequence:CCGGCCATAGCACATGGCTATCCTACTCGAGTAGGATAGCCATGTGCTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011925.1-1335s1c1
Sequence:CCGGCCGAGCGTCTCACTTAAACTTCTCGAGAAGTTTAAGTGAGACGCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011925.1-1416s1c1
Sequence:CCGGGTCACGTTCAAGTTCGACTTTCTCGAGAAAGTCGAACTTGAACGTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011925.1-316s1c1
Sequence:CCGGGCGTCTGTAACCTGGGATATACTCGAGTATATCCCAGGTTACAGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011925.1-246s1c1
Sequence:CCGGGAGTGTTTACTACCTGGATTTCTCGAGAAATCCAGGTAGTAAACACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011925
VALIDATED
CD97 MISSION shRNA Lentiviral Transduction Particles
CD97 molecule
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011925.2-2152s21c1
Sequence:CCGGGGCTATGGGCATGCAACATACCTCGAGGTATGTTGCATGCCCATAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011925.2-2643s21c1
Sequence:CCGGATGAAGGACAGCAGCACATACCTCGAGGTATGTGCTGCTGTCCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011925.2-1559s21c1
Sequence:CCGGTCACGTTCAAGTTCGACTTTACTCGAGTAAAGTCGAACTTGAACGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011925.2-1473s21c1
Sequence:CCGGGATTCCGAGTGTCTCACTTAACTCGAGTTAAGTGAGACACTCGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011925.2-460s21c1
Sequence:CCGGGTCTGTAACCTGGGATATAAGCTCGAGCTTATATCCCAGGTTACAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011925.1-2270s1c1
Sequence:CCGGCCATAGCACATGGCTATCCTACTCGAGTAGGATAGCCATGTGCTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011925.1-1335s1c1
Sequence:CCGGCCGAGCGTCTCACTTAAACTTCTCGAGAAGTTTAAGTGAGACGCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011925.1-1416s1c1
Sequence:CCGGGTCACGTTCAAGTTCGACTTTCTCGAGAAAGTCGAACTTGAACGTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011925.1-316s1c1
Sequence:CCGGGCGTCTGTAACCTGGGATATACTCGAGTATATCCCAGGTTACAGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011925.1-246s1c1
Sequence:CCGGGAGTGTTTACTACCTGGATTTCTCGAGAAATCCAGGTAGTAAACACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)