EMAIL THIS PAGE TO A FRIEND

CD99

CD99 molecule

129 Gene Product Result for
Synonyms: HBA71 MIC2 MIC2X MIC2Y MSK5X
UniProtKB ID: P14209, A6NIW1, O00518, Q6ICV7
Gene ID:
Human(4267) Summary: The protein encoded by this gene is a cell surface glycoprotein involved in leukocyte migration, T-cell adhesion, ganglioside GM1 and transmembrane protein transport, and T-cell death by a caspase-independent pathway. In addition, the encoded protein may have the ability to rearrange the actin cytoskeleton and may also act as an oncosuppressor in osteosarcoma. Cyclophilin A binds to CD99 and may act as a signaling regulator of CD99. This gene is found in the pseudoautosomal region of chromosomes X and Y and escapes X-chromosome inactivation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2013]
Mouse(673094) CD99 antigen
Rat(652929) CD99 molecule
Zebrafish(559896) CD99 molecule
cow(509230) CD99 molecule
dog(609832) CD99 molecule
chicken(418662) CD99 molecule
sheep(101115513) CD99 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1354 Human CD99 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002414 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052611 MISSION® esiRNA esiRNA human CD99 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122898 Rosetta Predictions human pricing
NM_002414 Rosetta Predictions human pricing
NM_001100804 Rosetta Predictions rat pricing
NM_025584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327547 predicted 539
2 SASI_Hs02_00327548 predicted 641
3 SASI_Hs02_00327549 predicted 654
4 SASI_Hs02_00327550 predicted 771
5 SASI_Hs02_00327551 predicted 698
6 SASI_Hs02_00327552 predicted 647
7 SASI_Hs02_00327553 predicted 707
8 SASI_Hs02_00327554 predicted 614
9 SASI_Hs02_00327555 predicted 700
10 SASI_Hs02_00327556 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333791 predicted 585
2 SASI_Hs02_00333792 predicted 697
3 SASI_Hs01_00083813 predicted 693
4 SASI_Hs01_00083815 predicted 818
5 SASI_Hs02_00333793 predicted 752
6 SASI_Hs02_00333794 predicted 687
7 SASI_Hs02_00333795 predicted 756
8 SASI_Hs01_00083819 predicted 666
9 SASI_Hs02_00333796 predicted 753
10 SASI_Hs02_00333797 predicted 697
11 SASI_Hs01_00083810 predicted 395
12 SASI_Hs01_00083811 predicted 623
13 SASI_Hs01_00083812 predicted 429
14 SASI_Hs01_00083814 predicted 236
15 SASI_Hs01_00083816 predicted 417
16 SASI_Hs01_00083817 predicted 341
17 SASI_Hs01_00083818 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210592 predicted 236
2 SASI_Rn02_00210593 predicted 233
3 SASI_Rn02_00210594 predicted 223
4 SASI_Rn02_00210595 predicted 268
5 SASI_Rn02_00210596 predicted 296
6 SASI_Rn02_00210597 predicted 270
7 SASI_Rn02_00210598 predicted 228
8 SASI_Rn02_00210599 predicted 396
9 SASI_Rn02_00210600 predicted 381
10 SASI_Rn02_00210601 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061516 predicted 682
2 SASI_Mm01_00061517 predicted 614
3 SASI_Mm02_00328562 predicted 279
4 SASI_Mm01_00061519 predicted 676
5 SASI_Mm01_00061520 predicted 297
6 SASI_Mm02_00328563 predicted 714
7 SASI_Mm01_00061521 predicted 673
8 SASI_Mm02_00328564 predicted 365
9 SASI_Mm01_00061522 predicted 284
10 SASI_Mm01_00061524 predicted 679
11 SASI_Mm01_00061518 predicted 626
12 SASI_Mm01_00061523 predicted 396
13 SASI_Mm01_00061525 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002414
VALIDATED
CD99 MISSION shRNA Bacterial Glycerol Stock
CD99 molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-239s1c1
Sequence:CCGGCGGATGGTGGTTTCGATTTATCTCGAGATAAATCGAAACCACCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-700s1c1
Sequence:CCGGCCAGCTGTTCAGCGTACTCTTCTCGAGAAGAGTACGCTGAACAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-467s1c1
Sequence:CCGGGCGTTTCAGGTGGAGAAGGAACTCGAGTTCCTTCTCCACCTGAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-604s1c1
Sequence:CCGGAGCTTCATTGCTTACCAGAAACTCGAGTTTCTGGTAAGCAATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-596s1c1
Sequence:CCGGCCATCTCTAGCTTCATTGCTTCTCGAGAAGCAATGAAGCTAGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002414.3-700s21c1
Sequence:CCGGCCAGCTGTTCAGCGTACTCTTCTCGAGAAGAGTACGCTGAACAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002414.3-239s21c1
Sequence:CCGGCGGATGGTGGTTTCGATTTATCTCGAGATAAATCGAAACCACCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002414.3-467s21c1
Sequence:CCGGGCGTTTCAGGTGGAGAAGGAACTCGAGTTCCTTCTCCACCTGAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002414.3-596s21c1
Sequence:CCGGCCATCTCTAGCTTCATTGCTTCTCGAGAAGCAATGAAGCTAGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002414
VALIDATED
CD99 MISSION shRNA shRNA Plasmid DNA
CD99 molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-239s1c1
Sequence:CCGGCGGATGGTGGTTTCGATTTATCTCGAGATAAATCGAAACCACCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-700s1c1
Sequence:CCGGCCAGCTGTTCAGCGTACTCTTCTCGAGAAGAGTACGCTGAACAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-467s1c1
Sequence:CCGGGCGTTTCAGGTGGAGAAGGAACTCGAGTTCCTTCTCCACCTGAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-604s1c1
Sequence:CCGGAGCTTCATTGCTTACCAGAAACTCGAGTTTCTGGTAAGCAATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-596s1c1
Sequence:CCGGCCATCTCTAGCTTCATTGCTTCTCGAGAAGCAATGAAGCTAGAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002414.3-700s21c1
Sequence:CCGGCCAGCTGTTCAGCGTACTCTTCTCGAGAAGAGTACGCTGAACAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002414.3-239s21c1
Sequence:CCGGCGGATGGTGGTTTCGATTTATCTCGAGATAAATCGAAACCACCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002414.3-467s21c1
Sequence:CCGGGCGTTTCAGGTGGAGAAGGAACTCGAGTTCCTTCTCCACCTGAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002414.3-596s21c1
Sequence:CCGGCCATCTCTAGCTTCATTGCTTCTCGAGAAGCAATGAAGCTAGAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002414
VALIDATED
CD99 MISSION shRNA Lentiviral Transduction Particles
CD99 molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-239s1c1
Sequence:CCGGCGGATGGTGGTTTCGATTTATCTCGAGATAAATCGAAACCACCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-700s1c1
Sequence:CCGGCCAGCTGTTCAGCGTACTCTTCTCGAGAAGAGTACGCTGAACAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-467s1c1
Sequence:CCGGGCGTTTCAGGTGGAGAAGGAACTCGAGTTCCTTCTCCACCTGAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-604s1c1
Sequence:CCGGAGCTTCATTGCTTACCAGAAACTCGAGTTTCTGGTAAGCAATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002414.3-596s1c1
Sequence:CCGGCCATCTCTAGCTTCATTGCTTCTCGAGAAGCAATGAAGCTAGAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002414.3-700s21c1
Sequence:CCGGCCAGCTGTTCAGCGTACTCTTCTCGAGAAGAGTACGCTGAACAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002414.3-239s21c1
Sequence:CCGGCGGATGGTGGTTTCGATTTATCTCGAGATAAATCGAAACCACCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002414.3-467s21c1
Sequence:CCGGGCGTTTCAGGTGGAGAAGGAACTCGAGTTCCTTCTCCACCTGAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002414.3-596s21c1
Sequence:CCGGCCATCTCTAGCTTCATTGCTTCTCGAGAAGCAATGAAGCTAGAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025584
CD99 MISSION shRNA Bacterial Glycerol Stock
CD99 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025584.1-593s1c1
Sequence:CCGGCCTCGCCTGAATATGCAAATACTCGAGTATTTGCATATTCAGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025584.1-84s1c1
Sequence:CCGGTGACGACTTCAACCTGGGCGACTCGAGTCGCCCAGGTTGAAGTCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025584.1-399s1c1
Sequence:CCGGCGGTGTCAAGCTTCGTGGCCTCTCGAGAGGCCACGAAGCTTGACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025584.1-159s1c1
Sequence:CCGGGCCGTCAGGAGGCTTCAACCTCTCGAGAGGTTGAAGCCTCCTGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025584.1-267s1c2
Sequence:CCGGACACGGAGACTCAGGCGGCATCTCGAGATGCCGCCTGAGTCTCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025584
CD99 MISSION shRNA shRNA Plasmid DNA
CD99 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025584.1-593s1c1
Sequence:CCGGCCTCGCCTGAATATGCAAATACTCGAGTATTTGCATATTCAGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025584.1-84s1c1
Sequence:CCGGTGACGACTTCAACCTGGGCGACTCGAGTCGCCCAGGTTGAAGTCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025584.1-399s1c1
Sequence:CCGGCGGTGTCAAGCTTCGTGGCCTCTCGAGAGGCCACGAAGCTTGACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025584.1-159s1c1
Sequence:CCGGGCCGTCAGGAGGCTTCAACCTCTCGAGAGGTTGAAGCCTCCTGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025584.1-267s1c2
Sequence:CCGGACACGGAGACTCAGGCGGCATCTCGAGATGCCGCCTGAGTCTCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025584
CD99 MISSION shRNA Lentiviral Transduction Particles
CD99 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025584.1-593s1c1
Sequence:CCGGCCTCGCCTGAATATGCAAATACTCGAGTATTTGCATATTCAGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025584.1-84s1c1
Sequence:CCGGTGACGACTTCAACCTGGGCGACTCGAGTCGCCCAGGTTGAAGTCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025584.1-399s1c1
Sequence:CCGGCGGTGTCAAGCTTCGTGGCCTCTCGAGAGGCCACGAAGCTTGACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025584.1-159s1c1
Sequence:CCGGGCCGTCAGGAGGCTTCAACCTCTCGAGAGGTTGAAGCCTCCTGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025584.1-267s1c2
Sequence:CCGGACACGGAGACTCAGGCGGCATCTCGAGATGCCGCCTGAGTCTCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)