EMAIL THIS PAGE TO A FRIEND

CD99L2

CD99 molecule-like 2

80 Gene Product Result for
Synonyms: CD99B MIC2L1
Gene ID:
Human(83692) Summary: This gene encodes a cell-surface protein that is similar to CD99. A similar protein in mouse functions as an adhesion molecule during leukocyte extravasation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(171486) CD99 antigen-like 2
Rat(171485) CD99 molecule-like 2
naked mole-rat(101701651) CD99 molecule-like 2
domestic guinea pig(100723860) CD99 molecule-like 2
sheep(101107422) CD99 molecule-like 2
Zebrafish(323266) CD99 antigen-like 2
chicken(422386) CD99 molecule-like 2
dog(100685328) CD99 molecule-like 2
cow(613644) CD99 molecule-like 2
domestic cat(101098447) CD99 molecule-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031462 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031462 Rosetta Predictions human pricing
NM_134445 Rosetta Predictions human pricing
NM_134446 Rosetta Predictions human pricing
NM_134459 Rosetta Predictions rat pricing
NM_138309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358886 predicted 1232
2 SASI_Hs01_00154670 predicted 1081
3 SASI_Hs01_00154671 predicted 1030
4 SASI_Hs01_00154672 predicted 1030
5 SASI_Hs01_00154673 predicted 738
6 SASI_Hs01_00154674 predicted 1087
7 SASI_Hs01_00154676 predicted 1232
8 SASI_Hs02_00358887 predicted 792
9 SASI_Hs01_00154677 predicted 1297
10 SASI_Hs01_00154678 predicted 1305
11 SASI_Hs01_00154675 predicted 1313
12 SASI_Hs01_00154679 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363330 predicted 1015
2 SASI_Hs01_00101827 predicted 866
3 SASI_Hs01_00101828 predicted 817
4 SASI_Hs01_00101829 predicted 813
5 SASI_Hs01_00101830 predicted 523
6 SASI_Hs01_00101831 predicted 872
7 SASI_Hs01_00101833 predicted 1012
8 SASI_Hs02_00363331 predicted 575
9 SASI_Hs01_00101834 predicted 1086
10 SASI_Hs01_00101835 predicted 1085
11 SASI_Hs01_00101832 predicted 1104
12 SASI_Hs01_00101836 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363332 predicted 1084
2 SASI_Hs01_00032849 predicted 934
3 SASI_Hs01_00032850 predicted 882
4 SASI_Hs01_00032851 predicted 883
5 SASI_Hs01_00032852 predicted 589
6 SASI_Hs01_00032853 predicted 941
7 SASI_Hs01_00032855 predicted 1077
8 SASI_Hs02_00363333 predicted 644
9 SASI_Hs01_00032856 predicted 1152
10 SASI_Hs01_00032857 predicted 1157
11 SASI_Hs01_00032854 predicted 1173
12 SASI_Hs01_00032858 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118766 predicted 673
2 SASI_Rn01_00118767 predicted 726
3 SASI_Rn01_00118768 predicted 802
4 SASI_Rn01_00118769 predicted 849
5 SASI_Rn01_00118770 predicted 787
6 SASI_Rn01_00118771 predicted 508
7 SASI_Rn01_00118772 predicted 845
8 SASI_Rn01_00118773 predicted 192
9 SASI_Rn01_00118775 predicted 1611
10 SASI_Rn02_00268057 predicted 807
11 SASI_Rn01_00118774 predicted 190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158119 predicted 784
2 SASI_Mm01_00158120 predicted 239
3 SASI_Mm01_00158121 predicted 601
4 SASI_Mm02_00339609 predicted 341
5 SASI_Mm01_00158122 predicted 441
6 SASI_Mm01_00158123 predicted 272
7 SASI_Mm01_00158124 predicted 898
8 SASI_Mm01_00158126 predicted 915
9 SASI_Mm01_00158127 predicted 417
10 SASI_Mm02_00339610 predicted 881
11 SASI_Mm01_00158125 predicted 356
12 SASI_Mm01_00158128 predicted 889
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031462
VALIDATED
CD99L2 MISSION shRNA Bacterial Glycerol Stock
CD99 molecule-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031462.2-1092s21c1
Sequence:CCGGTGAGACTTGGTGCCGAAATTCCTCGAGGAATTTCGGCACCAAGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031462.2-1227s21c1
Sequence:CCGGTGCTGAGGCCTGATGACATTTCTCGAGAAATGTCATCAGGCCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031462.2-439s21c1
Sequence:CCGGCACCAGAGCTCCAGCAAATACCTCGAGGTATTTGCTGGAGCTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031462.2-594s21c1
Sequence:CCGGACAAACCTGACAAGGGTAAAGCTCGAGCTTTACCCTTGTCAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031462.1-221s1c1
Sequence:CCGGGCAGTGAAAGAAACTTCCTCACTCGAGTGAGGAAGTTTCTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031462.1-1595s1c1
Sequence:CCGGCCGGATAAGTATGAAGCAATTCTCGAGAATTGCTTCATACTTATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_031462.1-341s1c1
Sequence:CCGGGATGCTTTGGATGATCAAGATCTCGAGATCTTGATCATCCAAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_031462.1-497s1c1
Sequence:CCGGGATCGAAATGATCGAGATGATCTCGAGATCATCTCGATCATTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031462
VALIDATED
CD99L2 MISSION shRNA shRNA Plasmid DNA
CD99 molecule-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031462.2-1092s21c1
Sequence:CCGGTGAGACTTGGTGCCGAAATTCCTCGAGGAATTTCGGCACCAAGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031462.2-1227s21c1
Sequence:CCGGTGCTGAGGCCTGATGACATTTCTCGAGAAATGTCATCAGGCCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031462.2-439s21c1
Sequence:CCGGCACCAGAGCTCCAGCAAATACCTCGAGGTATTTGCTGGAGCTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031462.2-594s21c1
Sequence:CCGGACAAACCTGACAAGGGTAAAGCTCGAGCTTTACCCTTGTCAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031462.1-221s1c1
Sequence:CCGGGCAGTGAAAGAAACTTCCTCACTCGAGTGAGGAAGTTTCTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031462.1-1595s1c1
Sequence:CCGGCCGGATAAGTATGAAGCAATTCTCGAGAATTGCTTCATACTTATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_031462.1-341s1c1
Sequence:CCGGGATGCTTTGGATGATCAAGATCTCGAGATCTTGATCATCCAAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_031462.1-497s1c1
Sequence:CCGGGATCGAAATGATCGAGATGATCTCGAGATCATCTCGATCATTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031462
VALIDATED
CD99L2 MISSION shRNA Lentiviral Transduction Particles
CD99 molecule-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031462.2-1092s21c1
Sequence:CCGGTGAGACTTGGTGCCGAAATTCCTCGAGGAATTTCGGCACCAAGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031462.2-1227s21c1
Sequence:CCGGTGCTGAGGCCTGATGACATTTCTCGAGAAATGTCATCAGGCCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031462.2-439s21c1
Sequence:CCGGCACCAGAGCTCCAGCAAATACCTCGAGGTATTTGCTGGAGCTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031462.2-594s21c1
Sequence:CCGGACAAACCTGACAAGGGTAAAGCTCGAGCTTTACCCTTGTCAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031462.1-221s1c1
Sequence:CCGGGCAGTGAAAGAAACTTCCTCACTCGAGTGAGGAAGTTTCTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_031462.1-1595s1c1
Sequence:CCGGCCGGATAAGTATGAAGCAATTCTCGAGAATTGCTTCATACTTATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_031462.1-341s1c1
Sequence:CCGGGATGCTTTGGATGATCAAGATCTCGAGATCTTGATCATCCAAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_031462.1-497s1c1
Sequence:CCGGGATCGAAATGATCGAGATGATCTCGAGATCATCTCGATCATTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138309
CD99L2 MISSION shRNA Bacterial Glycerol Stock
CD99 molecule-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138309.1-253s1c1
Sequence:CCGGCCTATGGAACTAGATGGGTTTCTCGAGAAACCCATCTAGTTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138309.1-1327s1c1
Sequence:CCGGCCCAACTTCATGTTTCATATTCTCGAGAATATGAAACATGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138309.1-283s1c1
Sequence:CCGGGATGCCTTGGATGATCGAAATCTCGAGATTTCGATCATCCAAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138309.1-446s1c1
Sequence:CCGGGATCTGGCATATCGACAGAAACTCGAGTTTCTGTCGATATGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138309.1-286s1c1
Sequence:CCGGGCCTTGGATGATCGAAATGATCTCGAGATCATTTCGATCATCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138309
CD99L2 MISSION shRNA shRNA Plasmid DNA
CD99 molecule-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138309.1-253s1c1
Sequence:CCGGCCTATGGAACTAGATGGGTTTCTCGAGAAACCCATCTAGTTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138309.1-1327s1c1
Sequence:CCGGCCCAACTTCATGTTTCATATTCTCGAGAATATGAAACATGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138309.1-283s1c1
Sequence:CCGGGATGCCTTGGATGATCGAAATCTCGAGATTTCGATCATCCAAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138309.1-446s1c1
Sequence:CCGGGATCTGGCATATCGACAGAAACTCGAGTTTCTGTCGATATGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138309.1-286s1c1
Sequence:CCGGGCCTTGGATGATCGAAATGATCTCGAGATCATTTCGATCATCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138309
CD99L2 MISSION shRNA Lentiviral Transduction Particles
CD99 molecule-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138309.1-253s1c1
Sequence:CCGGCCTATGGAACTAGATGGGTTTCTCGAGAAACCCATCTAGTTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138309.1-1327s1c1
Sequence:CCGGCCCAACTTCATGTTTCATATTCTCGAGAATATGAAACATGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138309.1-283s1c1
Sequence:CCGGGATGCCTTGGATGATCGAAATCTCGAGATTTCGATCATCCAAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138309.1-446s1c1
Sequence:CCGGGATCTGGCATATCGACAGAAACTCGAGTTTCTGTCGATATGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138309.1-286s1c1
Sequence:CCGGGCCTTGGATGATCGAAATGATCTCGAGATCATTTCGATCATCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks