EMAIL THIS PAGE TO A FRIEND

CD9

CD9 molecule

95 Gene Product Result for
Synonyms: BTCC-1 DRAP-27 MIC3 MRP-1 TSPAN-29 TSPAN29
UniProtKB ID: P21926, D3DUQ9, Q5J7W6, Q96ES4
Gene ID:
Human(928) Summary: This gene encodes a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Tetraspanins are cell surface glycoproteins with four transmembrane domains that form multimeric complexes with other cell surface proteins. The encoded protein functions in many cellular processes including differentiation, adhesion, and signal transduction, and expression of this gene plays a critical role in the suppression of cancer cell motility and metastasis. [provided by RefSeq, Jan 2011]
Mouse(12527) CD9 antigen
Rat(24936) CD9 molecule
Goat(100860808) CD9 molecule
sheep(100141299) CD9 molecule
chicken(395527) CD9 molecule
cow(280746) CD9 molecule
domestic cat(493874) CD9 molecule
dog(611695) CD9 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C9993 Anti-CD9 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunohistochemistry, western blot pricing
SAB4503606 Anti-CD9 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4700092 Monoclonal Anti-CD9 antibody produced in mouse clone MEM-61, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700618 Monoclonal Anti-CD9 antibody produced in mouse clone IVA50, purified immunoglobulin, buffered aqueous solution bovine
flow cytometry pricing
SAB1402143 Monoclonal Anti-CD9 antibody produced in mouse clone 4A2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4700567 Monoclonal Anti-Cd9 antibody produced in rat clone EM-04, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700091 Monoclonal Anti-CD9 azide free antibody produced in mouse clone MEM-61, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700093 Monoclonal Anti-CD9-APC antibody produced in mouse clone MEM-61, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700568 Monoclonal Anti-Cd9-APC antibody produced in rat clone EM-04, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700094 Monoclonal Anti-CD9-Biotin antibody produced in mouse clone MEM-61, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700095 Monoclonal Anti-CD9-FITC antibody produced in mouse clone MEM-61, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700569 Monoclonal Anti-Cd9-FITC antibody produced in rat clone EM-04, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700570 Monoclonal Anti-Cd9-PE antibody produced in rat clone EM-04, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007657 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007657 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007657 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001769 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001769 Rosetta Predictions human pricing
NM_053018 Rosetta Predictions rat pricing
NM_007657 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040299 predicted 582
2 SASI_Hs01_00040300 predicted 234
3 SASI_Hs01_00040301 predicted 229
4 SASI_Hs01_00040302 predicted 240
5 SASI_Hs01_00040304 predicted 392
6 SASI_Hs01_00040305 predicted 544
7 SASI_Hs01_00040308 predicted 621
8 SASI_Hs02_00332510 predicted 390
9 SASI_Hs02_00332511 predicted 523
10 SASI_Hs02_00332512 predicted 362
11 SASI_Hs01_00040303 predicted 454
12 SASI_Hs01_00040306 predicted 441
13 SASI_Hs01_00040307 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265626 predicted 205
2 SASI_Rn02_00265627 predicted 478
3 SASI_Rn02_00265628 predicted 386
4 SASI_Rn02_00265629 predicted 381
5 SASI_Rn02_00265630 predicted 563
6 SASI_Rn02_00265631 predicted 491
7 SASI_Rn02_00265632 predicted 534
8 SASI_Rn02_00265633 predicted 327
9 SASI_Rn02_00265634 predicted 492
10 SASI_Rn02_00265635 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094813 predicted 542
2 SASI_Mm01_00094815 predicted 553
3 SASI_Mm02_00312156 predicted 446
4 SASI_Mm02_00312157 predicted 229
5 SASI_Mm01_00094816 predicted 392
6 SASI_Mm01_00094817 predicted 540
7 SASI_Mm02_00312158 predicted 220
8 SASI_Mm01_00094818 predicted 575
9 SASI_Mm02_00312159 predicted 306
10 SASI_Mm01_00094819 predicted 586
11 SASI_Mm01_00094814 predicted 404
12 SASI_Mm01_00094820 predicted 214
13 SASI_Mm01_00094821 predicted 399
14 SASI_Mm01_00094822 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007657
VALIDATED
CD9 MISSION shRNA Bacterial Glycerol Stock
CD9 molecule
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007657.3-1030s1c1
Sequence:CCGGCCTGCAATGAAAGGTACTATACTCGAGTATAGTACCTTTCATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007657.3-155s1c1
Sequence:CCGGGCTCTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007657.3-677s1c1
Sequence:CCGGCAACAACAAGTTCCACATCATCTCGAGATGATGTGGAACTTGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007657.3-389s1c1
Sequence:CCGGCGGGTTCCTCTTGGTGATATTCTCGAGAATATCACCAAGAGGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007657.3-445s1c1
Sequence:CCGGCCCACAAGGATGAGGTGATTACTCGAGTAATCACCTCATCCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007657.3-578s21c1
Sequence:GTACCGGTGGTCCTTTGGAGCAGTTTATCTCGAGATAAACTGCTCCAAAGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007657.3-679s21c1
Sequence:GTACCGGACAACAAGTTCCACATCATTGCTCGAGCAATGATGTGGAACTTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007657.3-1030s21c1
Sequence:CCGGCCTGCAATGAAAGGTACTATACTCGAGTATAGTACCTTTCATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007657.3-389s21c1
Sequence:CCGGCGGGTTCCTCTTGGTGATATTCTCGAGAATATCACCAAGAGGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007657.3-155s21c1
Sequence:CCGGGCTCTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007657.3-446s21c1
Sequence:CCGGCCACAAGGATGAGGTGATTAACTCGAGTTAATCACCTCATCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007657.3-189s21c1
Sequence:GTACCGGGGCATTGCAGTGCTTGCTATTCTCGAGAATAGCAAGCACTGCAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007657
VALIDATED
CD9 MISSION shRNA shRNA Plasmid DNA
CD9 molecule
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007657.3-1030s1c1
Sequence:CCGGCCTGCAATGAAAGGTACTATACTCGAGTATAGTACCTTTCATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007657.3-155s1c1
Sequence:CCGGGCTCTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007657.3-677s1c1
Sequence:CCGGCAACAACAAGTTCCACATCATCTCGAGATGATGTGGAACTTGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007657.3-389s1c1
Sequence:CCGGCGGGTTCCTCTTGGTGATATTCTCGAGAATATCACCAAGAGGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007657.3-445s1c1
Sequence:CCGGCCCACAAGGATGAGGTGATTACTCGAGTAATCACCTCATCCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007657.3-578s21c1
Sequence:GTACCGGTGGTCCTTTGGAGCAGTTTATCTCGAGATAAACTGCTCCAAAGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007657.3-679s21c1
Sequence:GTACCGGACAACAAGTTCCACATCATTGCTCGAGCAATGATGTGGAACTTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007657.3-1030s21c1
Sequence:CCGGCCTGCAATGAAAGGTACTATACTCGAGTATAGTACCTTTCATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007657.3-389s21c1
Sequence:CCGGCGGGTTCCTCTTGGTGATATTCTCGAGAATATCACCAAGAGGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007657.3-155s21c1
Sequence:CCGGGCTCTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007657.3-446s21c1
Sequence:CCGGCCACAAGGATGAGGTGATTAACTCGAGTTAATCACCTCATCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007657.3-189s21c1
Sequence:GTACCGGGGCATTGCAGTGCTTGCTATTCTCGAGAATAGCAAGCACTGCAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007657
VALIDATED
CD9 MISSION shRNA Lentiviral Transduction Particles
CD9 molecule
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007657.3-1030s1c1
Sequence:CCGGCCTGCAATGAAAGGTACTATACTCGAGTATAGTACCTTTCATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007657.3-155s1c1
Sequence:CCGGGCTCTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007657.3-677s1c1
Sequence:CCGGCAACAACAAGTTCCACATCATCTCGAGATGATGTGGAACTTGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007657.3-389s1c1
Sequence:CCGGCGGGTTCCTCTTGGTGATATTCTCGAGAATATCACCAAGAGGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007657.3-445s1c1
Sequence:CCGGCCCACAAGGATGAGGTGATTACTCGAGTAATCACCTCATCCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007657.3-578s21c1
Sequence:GTACCGGTGGTCCTTTGGAGCAGTTTATCTCGAGATAAACTGCTCCAAAGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007657.3-679s21c1
Sequence:GTACCGGACAACAAGTTCCACATCATTGCTCGAGCAATGATGTGGAACTTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007657.3-1030s21c1
Sequence:CCGGCCTGCAATGAAAGGTACTATACTCGAGTATAGTACCTTTCATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007657.3-389s21c1
Sequence:CCGGCGGGTTCCTCTTGGTGATATTCTCGAGAATATCACCAAGAGGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007657.3-155s21c1
Sequence:CCGGGCTCTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007657.3-446s21c1
Sequence:CCGGCCACAAGGATGAGGTGATTAACTCGAGTTAATCACCTCATCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007657.3-189s21c1
Sequence:GTACCGGGGCATTGCAGTGCTTGCTATTCTCGAGAATAGCAAGCACTGCAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001769
VALIDATED
CD9 MISSION shRNA Bacterial Glycerol Stock
CD9 molecule
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001769.2-678s1c1
Sequence:CCGGCGACAATAAATTCCACATCATCTCGAGATGATGTGGAATTTATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001769.2-201s1c1
Sequence:CCGGCATTGGACTATGGCTCCGATTCTCGAGAATCGGAGCCATAGTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001769.2-150s1c1
Sequence:CCGGGCTGTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001769.2-729s1c1
Sequence:CCGGCATGATATTTGGCATGATCTTCTCGAGAAGATCATGCCAAATATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001769.2-390s1c1
Sequence:CCGGCGGCTTCCTCTTGGTGATATTCTCGAGAATATCACCAAGAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-150s21c1
Sequence:CCGGGCTGTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-1072s21c1
Sequence:CCGGCCTGCAATGAAAGGTACTATACTCGAGTATAGTACCTTTCATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-243s21c1
Sequence:CCGGCTTCGAGCAAGAAACTAATAACTCGAGTTATTAGTTTCTTGCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-277s21c1
Sequence:CCGGTTCTACACAGGAGTCTATATTCTCGAGAATATAGACTCCTGTGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-448s21c1
Sequence:CCGGCACAAGGATGAGGTGATTAAGCTCGAGCTTAATCACCTCATCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-665s21c1
Sequence:GTACCGGTCAAAGAGGTCTTCGACAATACTCGAGTATTGTCGAAGACCTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-716s21c1
Sequence:GTACCGGGCATTGCCGTGGTCATGATATCTCGAGATATCATGACCACGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-615s21c1
Sequence:GTACCGGCAAGAAGGACGTACTCGAAACCTCGAGGTTTCGAGTACGTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-192s21c1
Sequence:GTACCGGTGTCCTTGCCATTGGACTATGCTCGAGCATAGTCCAATGGCAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-544s21c1
Sequence:GTACCGGGCCATCCACTATGCGTTGAACCTCGAGGTTCAACGCATAGTGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001769
VALIDATED
CD9 MISSION shRNA shRNA Plasmid DNA
CD9 molecule
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001769.2-678s1c1
Sequence:CCGGCGACAATAAATTCCACATCATCTCGAGATGATGTGGAATTTATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001769.2-201s1c1
Sequence:CCGGCATTGGACTATGGCTCCGATTCTCGAGAATCGGAGCCATAGTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001769.2-150s1c1
Sequence:CCGGGCTGTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001769.2-729s1c1
Sequence:CCGGCATGATATTTGGCATGATCTTCTCGAGAAGATCATGCCAAATATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001769.2-390s1c1
Sequence:CCGGCGGCTTCCTCTTGGTGATATTCTCGAGAATATCACCAAGAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-150s21c1
Sequence:CCGGGCTGTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-1072s21c1
Sequence:CCGGCCTGCAATGAAAGGTACTATACTCGAGTATAGTACCTTTCATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-243s21c1
Sequence:CCGGCTTCGAGCAAGAAACTAATAACTCGAGTTATTAGTTTCTTGCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-277s21c1
Sequence:CCGGTTCTACACAGGAGTCTATATTCTCGAGAATATAGACTCCTGTGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-448s21c1
Sequence:CCGGCACAAGGATGAGGTGATTAAGCTCGAGCTTAATCACCTCATCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-665s21c1
Sequence:GTACCGGTCAAAGAGGTCTTCGACAATACTCGAGTATTGTCGAAGACCTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-716s21c1
Sequence:GTACCGGGCATTGCCGTGGTCATGATATCTCGAGATATCATGACCACGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-615s21c1
Sequence:GTACCGGCAAGAAGGACGTACTCGAAACCTCGAGGTTTCGAGTACGTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-192s21c1
Sequence:GTACCGGTGTCCTTGCCATTGGACTATGCTCGAGCATAGTCCAATGGCAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-544s21c1
Sequence:GTACCGGGCCATCCACTATGCGTTGAACCTCGAGGTTCAACGCATAGTGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001769
VALIDATED
CD9 MISSION shRNA Lentiviral Transduction Particles
CD9 molecule
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001769.2-678s1c1
Sequence:CCGGCGACAATAAATTCCACATCATCTCGAGATGATGTGGAATTTATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001769.2-201s1c1
Sequence:CCGGCATTGGACTATGGCTCCGATTCTCGAGAATCGGAGCCATAGTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001769.2-150s1c1
Sequence:CCGGGCTGTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001769.2-729s1c1
Sequence:CCGGCATGATATTTGGCATGATCTTCTCGAGAAGATCATGCCAAATATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001769.2-390s1c1
Sequence:CCGGCGGCTTCCTCTTGGTGATATTCTCGAGAATATCACCAAGAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-150s21c1
Sequence:CCGGGCTGTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-1072s21c1
Sequence:CCGGCCTGCAATGAAAGGTACTATACTCGAGTATAGTACCTTTCATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-243s21c1
Sequence:CCGGCTTCGAGCAAGAAACTAATAACTCGAGTTATTAGTTTCTTGCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-277s21c1
Sequence:CCGGTTCTACACAGGAGTCTATATTCTCGAGAATATAGACTCCTGTGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001769.2-448s21c1
Sequence:CCGGCACAAGGATGAGGTGATTAAGCTCGAGCTTAATCACCTCATCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-665s21c1
Sequence:GTACCGGTCAAAGAGGTCTTCGACAATACTCGAGTATTGTCGAAGACCTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-716s21c1
Sequence:GTACCGGGCATTGCCGTGGTCATGATATCTCGAGATATCATGACCACGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-615s21c1
Sequence:GTACCGGCAAGAAGGACGTACTCGAAACCTCGAGGTTTCGAGTACGTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-192s21c1
Sequence:GTACCGGTGTCCTTGCCATTGGACTATGCTCGAGCATAGTCCAATGGCAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001769.2-544s21c1
Sequence:GTACCGGGCCATCCACTATGCGTTGAACCTCGAGGTTCAACGCATAGTGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks