EMAIL THIS PAGE TO A FRIEND

CDA

cytidine deaminase

76 Gene Product Result for
Synonyms: CDD
UniProtKB ID: P32320
Gene ID:
Human(978) Summary: This gene encodes an enzyme involved in pyrimidine salvaging. The encoded protein forms a homotetramer that catalyzes the irreversible hydrolytic deamination of cytidine and deoxycytidine to uridine and deoxyuridine, respectively. It is one of several deaminases responsible for maintaining the cellular pyrimidine pool. Mutations in this gene are associated with decreased sensitivity to the cytosine nucleoside analogue cytosine arabinoside used in the treatment of certain childhood leukemias. [provided by RefSeq, Jul 2008]
Mouse(72269) cytidine deaminase
Rat(362638) cytidine deaminase
Zebrafish(402979) cytidine deaminase
cow(616377) cytidine deaminase
domestic cat(101092777) cytidine deaminase
dog(487393) cytidine deaminase
chicken(771849) cytidine deaminase
sheep(101102378) cytidine deaminase
domestic guinea pig(100720529) cytidine deaminase
naked mole-rat(101715225) cytidine deaminase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C1768 Cytosine β-D-arabinofuranoside crystalline, ≥90% (HPLC) human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001785 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001785 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001785 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017311 MISSION® esiRNA esiRNA targeting human CDA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001785 Rosetta Predictions human pricing
NM_001108688 Rosetta Predictions rat pricing
NM_028176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229075 predicted 647
2 SASI_Hs02_00332546 predicted 433
3 SASI_Hs01_00229077 predicted 498
4 SASI_Hs01_00229078 predicted 714
5 SASI_Hs01_00229079 predicted 412
6 SASI_Hs01_00229080 predicted 420
7 SASI_Hs01_00229081 predicted 502
8 SASI_Hs01_00229083 predicted 539
9 SASI_Hs01_00229084 predicted 417
10 SASI_Hs02_00332547 predicted 377
11 SASI_Hs01_00229076 predicted 330
12 SASI_Hs01_00229082 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241095 predicted 530
2 SASI_Rn02_00241096 predicted 491
3 SASI_Rn02_00241097 predicted 594
4 SASI_Rn02_00241098 predicted 629
5 SASI_Rn02_00241099 predicted 432
6 SASI_Rn02_00241100 predicted 200
7 SASI_Rn02_00241101 predicted 665
8 SASI_Rn02_00241102 predicted 218
9 SASI_Rn02_00241103 predicted 339
10 SASI_Rn02_00241104 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145586 predicted 546
2 SASI_Mm01_00145587 predicted 443
3 SASI_Mm01_00145588 predicted 296
4 SASI_Mm01_00145589 predicted 266
5 SASI_Mm01_00145591 predicted 461
6 SASI_Mm01_00145592 predicted 317
7 SASI_Mm01_00145593 predicted 486
8 SASI_Mm01_00145594 predicted 561
9 SASI_Mm01_00145595 predicted 373
10 SASI_Mm02_00333441 predicted 262
11 SASI_Mm01_00145590 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001785
VALIDATED
CDA MISSION shRNA Bacterial Glycerol Stock
cytidine deaminase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001785.1-432s1c1
Sequence:CCGGCATGAGAGAGTTTGGCACCAACTCGAGTTGGTGCCAAACTCTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001785.1-379s1c1
Sequence:CCGGGCCAGTGACATGCAAGATGATCTCGAGATCATCTTGCATGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001785.1-258s1c1
Sequence:CCGGGAGAATCTTCAAAGGGTGCAACTCGAGTTGCACCCTTTGAAGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001785.1-309s1c1
Sequence:CCGGCTGTGCTGAACGGACCGCTATCTCGAGATAGCGGTCCGTTCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001785.1-474s1c1
Sequence:CCGGGCCGGATGGTACGTATATTGTCTCGAGACAATATACGTACCATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001785.2-251s21c1
Sequence:CCGGGGCCAAGAAGTCAGCCTACTGCTCGAGCAGTAGGCTGACTTCTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001785.2-738s21c1
Sequence:CCGGATGTTTCCAGATTACACTCCACTCGAGTGGAGTGTAATCTGGAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001785
VALIDATED
CDA MISSION shRNA shRNA Plasmid DNA
cytidine deaminase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001785.1-432s1c1
Sequence:CCGGCATGAGAGAGTTTGGCACCAACTCGAGTTGGTGCCAAACTCTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001785.1-379s1c1
Sequence:CCGGGCCAGTGACATGCAAGATGATCTCGAGATCATCTTGCATGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001785.1-258s1c1
Sequence:CCGGGAGAATCTTCAAAGGGTGCAACTCGAGTTGCACCCTTTGAAGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001785.1-309s1c1
Sequence:CCGGCTGTGCTGAACGGACCGCTATCTCGAGATAGCGGTCCGTTCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001785.1-474s1c1
Sequence:CCGGGCCGGATGGTACGTATATTGTCTCGAGACAATATACGTACCATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001785.2-251s21c1
Sequence:CCGGGGCCAAGAAGTCAGCCTACTGCTCGAGCAGTAGGCTGACTTCTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001785.2-738s21c1
Sequence:CCGGATGTTTCCAGATTACACTCCACTCGAGTGGAGTGTAATCTGGAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001785
VALIDATED
CDA MISSION shRNA Lentiviral Transduction Particles
cytidine deaminase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001785.1-432s1c1
Sequence:CCGGCATGAGAGAGTTTGGCACCAACTCGAGTTGGTGCCAAACTCTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001785.1-379s1c1
Sequence:CCGGGCCAGTGACATGCAAGATGATCTCGAGATCATCTTGCATGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001785.1-258s1c1
Sequence:CCGGGAGAATCTTCAAAGGGTGCAACTCGAGTTGCACCCTTTGAAGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001785.1-309s1c1
Sequence:CCGGCTGTGCTGAACGGACCGCTATCTCGAGATAGCGGTCCGTTCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001785.1-474s1c1
Sequence:CCGGGCCGGATGGTACGTATATTGTCTCGAGACAATATACGTACCATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001785.2-251s21c1
Sequence:CCGGGGCCAAGAAGTCAGCCTACTGCTCGAGCAGTAGGCTGACTTCTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001785.2-738s21c1
Sequence:CCGGATGTTTCCAGATTACACTCCACTCGAGTGGAGTGTAATCTGGAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028176
VALIDATED
CDA MISSION shRNA Bacterial Glycerol Stock
cytidine deaminase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028176.1-427s1c1
Sequence:CCGGCCTGAAGACCTGCAGAAGATTCTCGAGAATCTTCTGCAGGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028176.1-505s1c1
Sequence:CCGGGCTCTTGGAAGACTTCATAATCTCGAGATTATGAAGTCTTCCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028176.1-239s1c1
Sequence:CCGGCCGAAGGGTACAAGGATTTCACTCGAGTGAAATCCTTGTACCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028176.1-289s1c1
Sequence:CCGGGAAGAGTTCATCTCTCCCTGTCTCGAGACAGGGAGAGATGAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028176.1-427s21c1
Sequence:CCGGCCTGAAGACCTGCAGAAGATTCTCGAGAATCTTCTGCAGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028176.1-505s21c1
Sequence:CCGGGCTCTTGGAAGACTTCATAATCTCGAGATTATGAAGTCTTCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028176.1-289s21c1
Sequence:CCGGGAAGAGTTCATCTCTCCCTGTCTCGAGACAGGGAGAGATGAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028176.1-239s21c1
Sequence:CCGGCCGAAGGGTACAAGGATTTCACTCGAGTGAAATCCTTGTACCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028176
VALIDATED
CDA MISSION shRNA shRNA Plasmid DNA
cytidine deaminase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028176.1-427s1c1
Sequence:CCGGCCTGAAGACCTGCAGAAGATTCTCGAGAATCTTCTGCAGGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028176.1-505s1c1
Sequence:CCGGGCTCTTGGAAGACTTCATAATCTCGAGATTATGAAGTCTTCCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028176.1-239s1c1
Sequence:CCGGCCGAAGGGTACAAGGATTTCACTCGAGTGAAATCCTTGTACCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028176.1-289s1c1
Sequence:CCGGGAAGAGTTCATCTCTCCCTGTCTCGAGACAGGGAGAGATGAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028176.1-427s21c1
Sequence:CCGGCCTGAAGACCTGCAGAAGATTCTCGAGAATCTTCTGCAGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028176.1-505s21c1
Sequence:CCGGGCTCTTGGAAGACTTCATAATCTCGAGATTATGAAGTCTTCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028176.1-289s21c1
Sequence:CCGGGAAGAGTTCATCTCTCCCTGTCTCGAGACAGGGAGAGATGAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028176.1-239s21c1
Sequence:CCGGCCGAAGGGTACAAGGATTTCACTCGAGTGAAATCCTTGTACCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028176
VALIDATED
CDA MISSION shRNA Lentiviral Transduction Particles
cytidine deaminase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028176.1-427s1c1
Sequence:CCGGCCTGAAGACCTGCAGAAGATTCTCGAGAATCTTCTGCAGGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028176.1-505s1c1
Sequence:CCGGGCTCTTGGAAGACTTCATAATCTCGAGATTATGAAGTCTTCCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028176.1-239s1c1
Sequence:CCGGCCGAAGGGTACAAGGATTTCACTCGAGTGAAATCCTTGTACCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028176.1-289s1c1
Sequence:CCGGGAAGAGTTCATCTCTCCCTGTCTCGAGACAGGGAGAGATGAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028176.1-427s21c1
Sequence:CCGGCCTGAAGACCTGCAGAAGATTCTCGAGAATCTTCTGCAGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028176.1-505s21c1
Sequence:CCGGGCTCTTGGAAGACTTCATAATCTCGAGATTATGAAGTCTTCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028176.1-289s21c1
Sequence:CCGGGAAGAGTTCATCTCTCCCTGTCTCGAGACAGGGAGAGATGAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028176.1-239s21c1
Sequence:CCGGCCGAAGGGTACAAGGATTTCACTCGAGTGAAATCCTTGTACCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks