EMAIL THIS PAGE TO A FRIEND

CDADC1

cytidine and dCMP deaminase domain containing 1

162 Gene Product Result for
Synonyms: NYD-SP15 bA103J18.1
UniProtKB ID: Q9BWV3, Q49A08, Q4G119, Q5TAW9, Q7Z764, Q9NT36
Gene ID:
Mouse(71891) cytidine and dCMP deaminase domain containing 1
Rat(361052) cytidine and dCMP deaminase domain containing 1
Zebrafish(492807) cytidine and dCMP deaminase domain containing 1
chicken(418864) cytidine and dCMP deaminase domain containing 1
cow(512184) cytidine and dCMP deaminase domain containing 1
Horse(100056457) cytidine and dCMP deaminase domain containing 1
domestic cat(101094724) cytidine and dCMP deaminase domain containing 1
dog(476913) cytidine and dCMP deaminase domain containing 1
naked mole-rat(101697815) cytidine and dCMP deaminase domain containing 1
domestic guinea pig(100719452) cytidine and dCMP deaminase domain containing 1
sheep(101115550) cytidine and dCMP deaminase domain containing 1
Domestic Rabbit(100341822) cytidine and dCMP deaminase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027986 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027986 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027986 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030911 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030911 Rosetta Predictions human pricing
NM_001012156 Rosetta Predictions rat pricing
XM_573797 Rosetta Predictions rat pricing
NM_027986 Rosetta Predictions mouse pricing
XM_001002774 Rosetta Predictions mouse pricing
XM_127813 Rosetta Predictions mouse pricing
XM_901847 Rosetta Predictions mouse pricing
XM_901853 Rosetta Predictions mouse pricing
XM_901857 Rosetta Predictions mouse pricing
XM_901866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019113 predicted 876
2 SASI_Hs01_00019115 predicted 1144
3 SASI_Hs02_00358445 predicted 1231
4 SASI_Hs01_00019116 predicted 1006
5 SASI_Hs01_00019117 predicted 1035
6 SASI_Hs01_00019118 predicted 1046
7 SASI_Hs01_00019119 predicted 1492
8 SASI_Hs02_00358446 predicted 672
9 SASI_Hs01_00019120 predicted 633
10 SASI_Hs02_00358447 predicted 1612
11 SASI_Hs01_00019112 predicted 1356
12 SASI_Hs01_00019114 predicted 985
13 SASI_Hs01_00019121 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107897 predicted 686
2 SASI_Rn01_00107898 predicted 1004
3 SASI_Rn01_00107899 predicted 419
4 SASI_Rn01_00107900 predicted 687
5 SASI_Rn01_00107902 predicted 1149
6 SASI_Rn01_00107903 predicted 676
7 SASI_Rn01_00107904 predicted 1150
8 SASI_Rn01_00107905 predicted 517
9 SASI_Rn02_00200343 predicted 708
10 SASI_Rn02_00200344 predicted 526
11 SASI_Rn01_00107901 predicted 516
12 SASI_Rn01_00107906 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172438 predicted 586
2 SASI_Rn01_00172439 predicted 437
3 SASI_Rn01_00172440 predicted 434
4 SASI_Rn01_00172441 predicted 713
5 SASI_Rn01_00172442 predicted 590
6 SASI_Rn01_00172443 predicted 700
7 SASI_Rn01_00172444 predicted 636
8 SASI_Rn01_00172445 predicted 540
9 SASI_Rn01_00172446 predicted 332
10 SASI_Rn01_00172447 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333038 predicted 636
2 SASI_Mm02_00333039 predicted 1463
3 SASI_Mm02_00333040 predicted 968
4 SASI_Mm02_00333041 predicted 1202
5 SASI_Mm02_00333042 predicted 1318
6 SASI_Mm02_00333043 predicted 929
7 SASI_Mm02_00333044 predicted 1084
8 SASI_Mm02_00333045 predicted 1430
9 SASI_Mm02_00333046 predicted 645
10 SASI_Mm02_00333047 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239614 predicted 648
2 SASI_Mm01_00239615 predicted 985
3 SASI_Mm01_00239616 predicted 1560
4 SASI_Mm01_00239617 predicted 1220
5 SASI_Mm01_00239618 predicted 1335
6 SASI_Mm01_00239619 predicted 951
7 SASI_Mm01_00239620 predicted 1100
8 SASI_Mm01_00239621 predicted 1442
9 SASI_Mm01_00239622 predicted 1153
10 SASI_Mm01_00239623 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281775 predicted 744
2 SASI_Mm01_00281776 predicted 982
3 SASI_Mm01_00281777 predicted 1219
4 SASI_Mm01_00281778 predicted 1296
5 SASI_Mm01_00281779 predicted 1335
6 SASI_Mm01_00281780 predicted 954
7 SASI_Mm01_00281781 predicted 1099
8 SASI_Mm01_00281782 predicted 1149
9 SASI_Mm01_00281783 predicted 738
10 SASI_Mm01_00281784 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236815 predicted 655
2 SASI_Mm01_00236816 predicted 744
3 SASI_Mm01_00236817 predicted 677
4 SASI_Mm01_00236818 predicted 880
5 SASI_Mm01_00236819 predicted 600
6 SASI_Mm01_00236820 predicted 729
7 SASI_Mm01_00236821 predicted 672
8 SASI_Mm01_00236822 predicted 646
9 SASI_Mm01_00236823 predicted 874
10 SASI_Mm01_00236824 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272457 predicted 650
2 SASI_Mm01_00272458 predicted 988
3 SASI_Mm01_00272459 predicted 1219
4 SASI_Mm01_00272460 predicted 1340
5 SASI_Mm01_00272461 predicted 1657
6 SASI_Mm01_00272462 predicted 953
7 SASI_Mm01_00272463 predicted 1100
8 SASI_Mm01_00272464 predicted 1451
9 SASI_Mm01_00272465 predicted 1617
10 SASI_Mm01_00272466 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251176 predicted 654
2 SASI_Mm01_00251177 predicted 980
3 SASI_Mm01_00251178 predicted 1558
4 SASI_Mm01_00251179 predicted 1215
5 SASI_Mm01_00251180 predicted 1334
6 SASI_Mm01_00251181 predicted 952
7 SASI_Mm01_00251182 predicted 1098
8 SASI_Mm01_00251183 predicted 1446
9 SASI_Mm01_00251184 predicted 1150
10 SASI_Mm01_00251185 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277529 predicted 738
2 SASI_Mm01_00277530 predicted 982
3 SASI_Mm01_00277531 predicted 1221
4 SASI_Mm01_00277532 predicted 1300
5 SASI_Mm01_00277533 predicted 1335
6 SASI_Mm01_00277534 predicted 946
7 SASI_Mm01_00277535 predicted 1104
8 SASI_Mm01_00277536 predicted 1152
9 SASI_Mm01_00277537 predicted 738
10 SASI_Mm01_00277538 predicted 1290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027986
VALIDATED
CDADC1 MISSION shRNA Bacterial Glycerol Stock
cytidine and dCMP deaminase domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027986.2-419s21c1
Sequence:CCGGGCTCCAGTGAAGACTTACATACTCGAGTATGTAAGTCTTCACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027986.2-539s21c1
Sequence:CCGGATGCTGGAGTTAACCGAATTTCTCGAGAAATTCGGTTAACTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027986.2-638s21c1
Sequence:CCGGCCGCAGAAAGATTGAAGTCAACTCGAGTTGACTTCAATCTTTCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027986.2-1101s21c1
Sequence:CCGGATATCGAACTGAGGATCATAACTCGAGTTATGATCCTCAGTTCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027986.2-1846s21c1
Sequence:CCGGGAACAGTACCTACTGGTATTTCTCGAGAAATACCAGTAGGTACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027986
VALIDATED
CDADC1 MISSION shRNA shRNA Plasmid DNA
cytidine and dCMP deaminase domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027986.2-419s21c1
Sequence:CCGGGCTCCAGTGAAGACTTACATACTCGAGTATGTAAGTCTTCACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027986.2-539s21c1
Sequence:CCGGATGCTGGAGTTAACCGAATTTCTCGAGAAATTCGGTTAACTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027986.2-638s21c1
Sequence:CCGGCCGCAGAAAGATTGAAGTCAACTCGAGTTGACTTCAATCTTTCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027986.2-1101s21c1
Sequence:CCGGATATCGAACTGAGGATCATAACTCGAGTTATGATCCTCAGTTCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027986.2-1846s21c1
Sequence:CCGGGAACAGTACCTACTGGTATTTCTCGAGAAATACCAGTAGGTACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027986
VALIDATED
CDADC1 MISSION shRNA Lentiviral Transduction Particles
cytidine and dCMP deaminase domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027986.2-419s21c1
Sequence:CCGGGCTCCAGTGAAGACTTACATACTCGAGTATGTAAGTCTTCACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027986.2-539s21c1
Sequence:CCGGATGCTGGAGTTAACCGAATTTCTCGAGAAATTCGGTTAACTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027986.2-638s21c1
Sequence:CCGGCCGCAGAAAGATTGAAGTCAACTCGAGTTGACTTCAATCTTTCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027986.2-1101s21c1
Sequence:CCGGATATCGAACTGAGGATCATAACTCGAGTTATGATCCTCAGTTCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027986.2-1846s21c1
Sequence:CCGGGAACAGTACCTACTGGTATTTCTCGAGAAATACCAGTAGGTACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030911
VALIDATED
CDADC1 MISSION shRNA Bacterial Glycerol Stock
cytidine and dCMP deaminase domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030911.1-1066s21c1
Sequence:GTACCGGATATCGAACTGAGGATCATAACTCGAGTTATGATCCTCAGTTCGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030911.1-977s21c1
Sequence:GTACCGGAGCAATCCAGAACAGATTAATCTCGAGATTAATCTGTTCTGGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030911.1-2008s21c1
Sequence:GTACCGGACAAGAGTGACAGTTAGTAAACTCGAGTTTACTAACTGTCACTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030911.1-737s1c2
Sequence:CCGGCCGGATGCTAACACTGACTTTCTCGAGAAAGTCAGTGTTAGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030911.1-874s21c1
Sequence:CCGGTCCATACTTTAGCAATCTAAGCTCGAGCTTAGATTGCTAAAGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030911.1-504s21c1
Sequence:CCGGATGCTGGAGTTAACCGAATTTCTCGAGAAATTCGGTTAACTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030911.1-2872s1c1
Sequence:CCGGGCAGCCAAGAACTGCCATAAACTCGAGTTTATGGCAGTTCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030911.1-405s1c1
Sequence:CCGGCCGGGCAGATTGCTCTTATTACTCGAGTAATAAGAGCAATCTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_030911.1-974s1c1
Sequence:CCGGCGTAGCAATCCAGAACAGATTCTCGAGAATCTGTTCTGGATTGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030911.1-1283s1c1
Sequence:CCGGGCCTTGACATTTAGGTGTCAACTCGAGTTGACACCTAAATGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030911
VALIDATED
CDADC1 MISSION shRNA shRNA Plasmid DNA
cytidine and dCMP deaminase domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030911.1-1066s21c1
Sequence:GTACCGGATATCGAACTGAGGATCATAACTCGAGTTATGATCCTCAGTTCGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030911.1-977s21c1
Sequence:GTACCGGAGCAATCCAGAACAGATTAATCTCGAGATTAATCTGTTCTGGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030911.1-2008s21c1
Sequence:GTACCGGACAAGAGTGACAGTTAGTAAACTCGAGTTTACTAACTGTCACTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030911.1-737s1c2
Sequence:CCGGCCGGATGCTAACACTGACTTTCTCGAGAAAGTCAGTGTTAGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030911.1-874s21c1
Sequence:CCGGTCCATACTTTAGCAATCTAAGCTCGAGCTTAGATTGCTAAAGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030911.1-504s21c1
Sequence:CCGGATGCTGGAGTTAACCGAATTTCTCGAGAAATTCGGTTAACTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030911.1-2872s1c1
Sequence:CCGGGCAGCCAAGAACTGCCATAAACTCGAGTTTATGGCAGTTCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030911.1-405s1c1
Sequence:CCGGCCGGGCAGATTGCTCTTATTACTCGAGTAATAAGAGCAATCTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_030911.1-974s1c1
Sequence:CCGGCGTAGCAATCCAGAACAGATTCTCGAGAATCTGTTCTGGATTGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030911.1-1283s1c1
Sequence:CCGGGCCTTGACATTTAGGTGTCAACTCGAGTTGACACCTAAATGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030911
VALIDATED
CDADC1 MISSION shRNA Lentiviral Transduction Particles
cytidine and dCMP deaminase domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030911.1-1066s21c1
Sequence:GTACCGGATATCGAACTGAGGATCATAACTCGAGTTATGATCCTCAGTTCGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030911.1-977s21c1
Sequence:GTACCGGAGCAATCCAGAACAGATTAATCTCGAGATTAATCTGTTCTGGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030911.1-2008s21c1
Sequence:GTACCGGACAAGAGTGACAGTTAGTAAACTCGAGTTTACTAACTGTCACTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030911.1-737s1c2
Sequence:CCGGCCGGATGCTAACACTGACTTTCTCGAGAAAGTCAGTGTTAGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030911.1-874s21c1
Sequence:CCGGTCCATACTTTAGCAATCTAAGCTCGAGCTTAGATTGCTAAAGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030911.1-504s21c1
Sequence:CCGGATGCTGGAGTTAACCGAATTTCTCGAGAAATTCGGTTAACTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030911.1-2872s1c1
Sequence:CCGGGCAGCCAAGAACTGCCATAAACTCGAGTTTATGGCAGTTCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030911.1-405s1c1
Sequence:CCGGCCGGGCAGATTGCTCTTATTACTCGAGTAATAAGAGCAATCTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_030911.1-974s1c1
Sequence:CCGGCGTAGCAATCCAGAACAGATTCTCGAGAATCTGTTCTGGATTGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030911.1-1283s1c1
Sequence:CCGGGCCTTGACATTTAGGTGTCAACTCGAGTTGACACCTAAATGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127813
VALIDATED
CDADC1 MISSION shRNA Bacterial Glycerol Stock
cytidine and dCMP deaminase domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127813.3-638s1c1
Sequence:CCGGCCGCAGAAAGATTGAAGTCAACTCGAGTTGACTTCAATCTTTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127813.3-419s1c1
Sequence:CCGGGCTCCAGTGAAGACTTACATACTCGAGTATGTAAGTCTTCACTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127813.3-188s1c1
Sequence:CCGGCGGGTCAAATACCAAGGCTTTCTCGAGAAAGCCTTGGTATTTGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127813.3-1417s1c1
Sequence:CCGGGCAGGCATAAAGCAGATCTATCTCGAGATAGATCTGCTTTATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127813.3-1247s1c1
Sequence:CCGGCGCACATGGATGACAAGCATACTCGAGTATGCTTGTCATCCATGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127813
VALIDATED
CDADC1 MISSION shRNA shRNA Plasmid DNA
cytidine and dCMP deaminase domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127813.3-638s1c1
Sequence:CCGGCCGCAGAAAGATTGAAGTCAACTCGAGTTGACTTCAATCTTTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127813.3-419s1c1
Sequence:CCGGGCTCCAGTGAAGACTTACATACTCGAGTATGTAAGTCTTCACTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127813.3-188s1c1
Sequence:CCGGCGGGTCAAATACCAAGGCTTTCTCGAGAAAGCCTTGGTATTTGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127813.3-1417s1c1
Sequence:CCGGGCAGGCATAAAGCAGATCTATCTCGAGATAGATCTGCTTTATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127813.3-1247s1c1
Sequence:CCGGCGCACATGGATGACAAGCATACTCGAGTATGCTTGTCATCCATGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127813
VALIDATED
CDADC1 MISSION shRNA Lentiviral Transduction Particles
cytidine and dCMP deaminase domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127813.3-638s1c1
Sequence:CCGGCCGCAGAAAGATTGAAGTCAACTCGAGTTGACTTCAATCTTTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127813.3-419s1c1
Sequence:CCGGGCTCCAGTGAAGACTTACATACTCGAGTATGTAAGTCTTCACTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127813.3-188s1c1
Sequence:CCGGCGGGTCAAATACCAAGGCTTTCTCGAGAAAGCCTTGGTATTTGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127813.3-1417s1c1
Sequence:CCGGGCAGGCATAAAGCAGATCTATCTCGAGATAGATCTGCTTTATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127813.3-1247s1c1
Sequence:CCGGCGCACATGGATGACAAGCATACTCGAGTATGCTTGTCATCCATGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks