EMAIL THIS PAGE TO A FRIEND

CDAN1

codanin 1

99 Gene Product Result for
Synonyms: CDA1 CDAI DLT PRO1295
UniProtKB ID: Q8IWY9, Q6NYD0, Q7Z7L5, Q969N3
Gene ID:
Human(146059) Summary: This gene encodes a protein that appears to play a role in nuclear envelope integrity, possibly related to microtubule attachments. Mutations in this gene cause congenital dyserythropoietic anemia type I, a disease resulting in morphological and functional abnormalities of erythropoiesis. [provided by RefSeq, Jul 2009]
Mouse(68968) congenital dyserythropoietic anemia, type I (human)
Rat(311348) codanin 1
Zebrafish(565314) congenital dyserythropoietic anemia, type I
cow(538940) codanin 1
dog(608886) codanin 1
chicken(423239) codanin 1
sheep(101118193) codanin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138477 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122821 MISSION® esiRNA esiRNA human CDAN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138477 Rosetta Predictions human pricing
NM_001107765 Rosetta Predictions rat pricing
NM_026891 Rosetta Predictions mouse pricing
XM_485054 Rosetta Predictions mouse pricing
XM_893344 Rosetta Predictions mouse pricing
XM_900775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045788 predicted 1052
2 SASI_Hs01_00045790 predicted 1418
3 SASI_Hs01_00045791 predicted 3678
4 SASI_Hs01_00045793 predicted 2721
5 SASI_Hs01_00045794 predicted 2020
6 SASI_Hs01_00045795 predicted 2731
7 SASI_Hs01_00045797 predicted 3741
8 SASI_Hs02_00363666 predicted 1987
9 SASI_Hs02_00363667 predicted 1034
10 SASI_Hs02_00363668 predicted 1760
11 SASI_Hs01_00045789 predicted 2215
12 SASI_Hs01_00045792 predicted 3072
13 SASI_Hs01_00045796 predicted 2431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232045 predicted 1396
2 SASI_Rn02_00232046 predicted 1198
3 SASI_Rn02_00232047 predicted 1127
4 SASI_Rn02_00232048 predicted 985
5 SASI_Rn02_00232049 predicted 1095
6 SASI_Rn02_00232050 predicted 827
7 SASI_Rn02_00232051 predicted 583
8 SASI_Rn02_00232052 predicted 368
9 SASI_Rn02_00232053 predicted 1349
10 SASI_Rn02_00232054 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331152 predicted 2202
2 SASI_Mm02_00331153 predicted 2208
3 SASI_Mm02_00331154 predicted 3676
4 SASI_Mm02_00331155 predicted 968
5 SASI_Mm02_00331156 predicted 1896
6 SASI_Mm02_00331157 predicted 2337
7 SASI_Mm02_00331158 predicted 1115
8 SASI_Mm02_00331159 predicted 1484
9 SASI_Mm02_00331160 predicted 1173
10 SASI_Mm02_00331161 predicted 3689
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253171 predicted 2204
2 SASI_Mm01_00253172 predicted 3656
3 SASI_Mm01_00253173 predicted 3602
4 SASI_Mm01_00253174 predicted 977
5 SASI_Mm01_00253175 predicted 1900
6 SASI_Mm01_00253176 predicted 2899
7 SASI_Mm01_00253177 predicted 1113
8 SASI_Mm01_00253178 predicted 1495
9 SASI_Mm01_00253179 predicted 1177
10 SASI_Mm01_00253180 predicted 3665
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267998 predicted 1609
2 SASI_Mm01_00267999 predicted 3059
3 SASI_Mm01_00268000 predicted 2996
4 SASI_Mm01_00268001 predicted 382
5 SASI_Mm01_00268002 predicted 1305
6 SASI_Mm01_00268003 predicted 2304
7 SASI_Mm01_00268004 predicted 525
8 SASI_Mm01_00268005 predicted 894
9 SASI_Mm01_00268006 predicted 577
10 SASI_Mm01_00268007 predicted 3065
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204316 predicted 1918
2 SASI_Mm01_00204317 predicted 1364
3 SASI_Mm01_00204318 predicted 1885
4 SASI_Mm01_00204319 predicted 1307
5 SASI_Mm01_00204320 predicted 1827
6 SASI_Mm01_00204321 predicted 1729
7 SASI_Mm01_00204322 predicted 1257
8 SASI_Mm01_00204323 predicted 1712
9 SASI_Mm01_00204324 predicted 1380
10 SASI_Mm01_00204325 predicted 1775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138477
CDAN1 MISSION shRNA Bacterial Glycerol Stock
codanin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138477.1-4179s1c1
Sequence:CCGGCCTGCTTAACTTATGAAGAAACTCGAGTTTCTTCATAAGTTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138477.1-3189s1c1
Sequence:CCGGCCACCTCATCTCCGAGATAAACTCGAGTTTATCTCGGAGATGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138477.1-1032s1c1
Sequence:CCGGCCTTGTTTACTCCTCGTGCATCTCGAGATGCACGAGGAGTAAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138477.1-2241s1c1
Sequence:CCGGGCTGGAATATTACCGGGACATCTCGAGATGTCCCGGTAATATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138477.1-3375s1c1
Sequence:CCGGCCTCCTCGTTGCAGATCAAATCTCGAGATTTGATCTGCAACGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138477.2-4213s21c1
Sequence:CCGGGAATCTTGGGAGTCTACATTTCTCGAGAAATGTAGACTCCCAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138477.2-3068s21c1
Sequence:CCGGTGATCAGGAGGGAGGTGAAAGCTCGAGCTTTCACCTCCCTCCTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138477
CDAN1 MISSION shRNA shRNA Plasmid DNA
codanin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138477.1-4179s1c1
Sequence:CCGGCCTGCTTAACTTATGAAGAAACTCGAGTTTCTTCATAAGTTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138477.1-3189s1c1
Sequence:CCGGCCACCTCATCTCCGAGATAAACTCGAGTTTATCTCGGAGATGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138477.1-1032s1c1
Sequence:CCGGCCTTGTTTACTCCTCGTGCATCTCGAGATGCACGAGGAGTAAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138477.1-2241s1c1
Sequence:CCGGGCTGGAATATTACCGGGACATCTCGAGATGTCCCGGTAATATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138477.1-3375s1c1
Sequence:CCGGCCTCCTCGTTGCAGATCAAATCTCGAGATTTGATCTGCAACGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138477.2-4213s21c1
Sequence:CCGGGAATCTTGGGAGTCTACATTTCTCGAGAAATGTAGACTCCCAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138477.2-3068s21c1
Sequence:CCGGTGATCAGGAGGGAGGTGAAAGCTCGAGCTTTCACCTCCCTCCTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138477
CDAN1 MISSION shRNA Lentiviral Transduction Particles
codanin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138477.1-4179s1c1
Sequence:CCGGCCTGCTTAACTTATGAAGAAACTCGAGTTTCTTCATAAGTTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138477.1-3189s1c1
Sequence:CCGGCCACCTCATCTCCGAGATAAACTCGAGTTTATCTCGGAGATGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138477.1-1032s1c1
Sequence:CCGGCCTTGTTTACTCCTCGTGCATCTCGAGATGCACGAGGAGTAAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138477.1-2241s1c1
Sequence:CCGGGCTGGAATATTACCGGGACATCTCGAGATGTCCCGGTAATATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138477.1-3375s1c1
Sequence:CCGGCCTCCTCGTTGCAGATCAAATCTCGAGATTTGATCTGCAACGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138477.2-4213s21c1
Sequence:CCGGGAATCTTGGGAGTCTACATTTCTCGAGAAATGTAGACTCCCAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138477.2-3068s21c1
Sequence:CCGGTGATCAGGAGGGAGGTGAAAGCTCGAGCTTTCACCTCCCTCCTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026891
VALIDATED
CDAN1 MISSION shRNA Bacterial Glycerol Stock
codanin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026891.2-2192s21c1
Sequence:CCGGCTGCGCTTACATCGGAGTTTGCTCGAGCAAACTCCGATGTAAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026891.2-1784s21c1
Sequence:CCGGCAGCACCTCATGGATAGTTTACTCGAGTAAACTATCCATGAGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026891.2-5001s21c1
Sequence:CCGGATGTGCCCAAAGATAGTATTTCTCGAGAAATACTATCTTTGGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026891.2-2399s21c1
Sequence:CCGGGTGGACCAGCAGCTGTTATATCTCGAGATATAACAGCTGCTGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026891.2-2967s21c1
Sequence:CCGGCCAACATCACAGCGCTGATTACTCGAGTAATCAGCGCTGTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026891
VALIDATED
CDAN1 MISSION shRNA shRNA Plasmid DNA
codanin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026891.2-2192s21c1
Sequence:CCGGCTGCGCTTACATCGGAGTTTGCTCGAGCAAACTCCGATGTAAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026891.2-1784s21c1
Sequence:CCGGCAGCACCTCATGGATAGTTTACTCGAGTAAACTATCCATGAGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026891.2-5001s21c1
Sequence:CCGGATGTGCCCAAAGATAGTATTTCTCGAGAAATACTATCTTTGGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026891.2-2399s21c1
Sequence:CCGGGTGGACCAGCAGCTGTTATATCTCGAGATATAACAGCTGCTGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026891.2-2967s21c1
Sequence:CCGGCCAACATCACAGCGCTGATTACTCGAGTAATCAGCGCTGTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026891
VALIDATED
CDAN1 MISSION shRNA Lentiviral Transduction Particles
codanin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026891.2-2192s21c1
Sequence:CCGGCTGCGCTTACATCGGAGTTTGCTCGAGCAAACTCCGATGTAAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026891.2-1784s21c1
Sequence:CCGGCAGCACCTCATGGATAGTTTACTCGAGTAAACTATCCATGAGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026891.2-5001s21c1
Sequence:CCGGATGTGCCCAAAGATAGTATTTCTCGAGAAATACTATCTTTGGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026891.2-2399s21c1
Sequence:CCGGGTGGACCAGCAGCTGTTATATCTCGAGATATAACAGCTGCTGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026891.2-2967s21c1
Sequence:CCGGCCAACATCACAGCGCTGATTACTCGAGTAATCAGCGCTGTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks