EMAIL THIS PAGE TO A FRIEND

CDC123

cell division cycle 123

68 Gene Product Result for
Synonyms: C10orf7 D123
Gene ID:
Mouse(98828) cell division cycle 123
Rat(116656) cell division cycle 123
Zebrafish(393694) cell division cycle 123 homolog (S. cerevisiae)
cow(514926) cell division cycle 123 homolog (S. cerevisiae)
Horse(100056777) cell division cycle 123 homolog (S. cerevisiae)
domestic cat(101084888) cell division cycle 123 homolog (S. cerevisiae)
dog(478005) cell division cycle 123 homolog (S. cerevisiae)
chicken(426366) cell division cycle 123 homolog (S. cerevisiae)
naked mole-rat(101724853) cell division cycle 123
domestic guinea pig(100723172) cell division cycle 123
sheep(101117525) cell division cycle 123 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006023 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006023 Rosetta Predictions human pricing
NM_053877 Rosetta Predictions rat pricing
NM_133837 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056140 predicted 1227
2 SASI_Hs01_00056141 predicted 627
3 SASI_Hs02_00340750 predicted 720
4 SASI_Hs01_00056142 predicted 680
5 SASI_Hs01_00056144 predicted 1174
6 SASI_Hs01_00056145 predicted 937
7 SASI_Hs01_00056146 predicted 1001
8 SASI_Hs01_00056147 predicted 611
9 SASI_Hs01_00056148 predicted 851
10 SASI_Hs01_00056149 predicted 711
11 SASI_Hs01_00056143 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051707 predicted 474
2 SASI_Rn01_00051708 predicted 588
3 SASI_Rn02_00266782 predicted 453
4 SASI_Rn01_00051709 predicted 276
5 SASI_Rn01_00051710 predicted 628
6 SASI_Rn01_00051711 predicted 477
7 SASI_Rn01_00051712 predicted 375
8 SASI_Rn01_00051714 predicted 705
9 SASI_Rn01_00051716 predicted 373
10 SASI_Rn02_00266783 predicted 594
11 SASI_Rn01_00051713 predicted 1071
12 SASI_Rn01_00051715 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069622 predicted 621
2 SASI_Mm01_00069623 predicted 312
3 SASI_Mm01_00069624 predicted 629
4 SASI_Mm01_00069625 predicted 392
5 SASI_Mm01_00069626 predicted 455
6 SASI_Mm01_00069627 predicted 459
7 SASI_Mm01_00069628 predicted 429
8 SASI_Mm01_00069629 predicted 602
9 SASI_Mm01_00069630 predicted 454
10 SASI_Mm01_00069631 predicted 342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006023
VALIDATED
CDC123 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 123
Human
22 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006023.1-331s21c1
Sequence:CCGGCTTCCGAGGCGTTACCATCAACTCGAGTTGATGGTAACGCCTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-865s21c1
Sequence:CCGGCACACAATACTATGATCATATCTCGAGATATGATCATAGTATTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-939s21c1
Sequence:CCGGACATACAGTACAAATTCTTAGCTCGAGCTAAGAATTTGTACTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-746s21c1
Sequence:CCGGCCAGATCCATGTATAGAATATCTCGAGATATTCTATACATGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-1057s21c1
Sequence:CCGGCACCTGGGAAGAACTGATATCCTCGAGGATATCAGTTCTTCCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-547s21c1
Sequence:CCGGAGTCCAGGAACCTATCAATTCCTCGAGGAATTGATAGGTTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-1133s21c1
Sequence:CCGGCCAGCTTTCCGTTGCACAAACCTCGAGGTTTGTGCAACGGAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-964s21c1
Sequence:CCGGAGACTTTGTGTTCGATATATACTCGAGTATATATCGAACACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-509s21c1
Sequence:CCGGACGCTTACGGCACCAGAATTTCTCGAGAAATTCTGGTGCCGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-372s21c1
Sequence:CCGGCTCAGAATGTGAAGGATTATTCTCGAGAATAATCCTTCACATTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-1293s1c1
Sequence:CCGGGAGCGTACTGTAACTGGAGAACTCGAGTTCTCCAGTTACAGTACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-719s1c1
Sequence:CCGGCCGTTTATTCATTGTACTGATCTCGAGATCAGTACAATGAATAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-618s1c1
Sequence:CCGGCGTATTGGATAGCAATGAATACTCGAGTATTCATTGCTATCCAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-1016s1c1
Sequence:CCGGGACTTTAATCCATTTGGTGAACTCGAGTTCACCAAATGGATTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-1009s1c1
Sequence:CCGGGCTCATTGACTTTAATCCATTCTCGAGAATGGATTAAAGTCAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-1081s1c1
Sequence:CCGGGAACAACTTAAACGGCGATTTCTCGAGAAATCGCCGTTTAAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-744s1c1
Sequence:CCGGCTCCAGATCCATGTATAGAATCTCGAGATTCTATACATGGATCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-1079s1c1
Sequence:CCGGGAGAACAACTTAAACGGCGATCTCGAGATCGCCGTTTAAGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-576s1c1
Sequence:CCGGGCAGTGTCTTTCCTAAGCTTACTCGAGTAAGCTTAGGAAAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-691s1c1
Sequence:CCGGCGATTTCATCACTCGTGACTTCTCGAGAAGTCACGAGTGATGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-1178s1c1
Sequence:CCGGCCCTATTTGAGTTACCGGCTACTCGAGTAGCCGGTAACTCAAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-1234s1c1
Sequence:CCGGCGCTCACAAGCTAATAGACTTCTCGAGAAGTCTATTAGCTTGTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006023
VALIDATED
CDC123 MISSION shRNA shRNA Plasmid DNA
cell division cycle 123
Human
22 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006023.1-331s21c1
Sequence:CCGGCTTCCGAGGCGTTACCATCAACTCGAGTTGATGGTAACGCCTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-865s21c1
Sequence:CCGGCACACAATACTATGATCATATCTCGAGATATGATCATAGTATTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-939s21c1
Sequence:CCGGACATACAGTACAAATTCTTAGCTCGAGCTAAGAATTTGTACTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-746s21c1
Sequence:CCGGCCAGATCCATGTATAGAATATCTCGAGATATTCTATACATGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-1057s21c1
Sequence:CCGGCACCTGGGAAGAACTGATATCCTCGAGGATATCAGTTCTTCCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-547s21c1
Sequence:CCGGAGTCCAGGAACCTATCAATTCCTCGAGGAATTGATAGGTTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-1133s21c1
Sequence:CCGGCCAGCTTTCCGTTGCACAAACCTCGAGGTTTGTGCAACGGAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-964s21c1
Sequence:CCGGAGACTTTGTGTTCGATATATACTCGAGTATATATCGAACACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-509s21c1
Sequence:CCGGACGCTTACGGCACCAGAATTTCTCGAGAAATTCTGGTGCCGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-372s21c1
Sequence:CCGGCTCAGAATGTGAAGGATTATTCTCGAGAATAATCCTTCACATTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-1293s1c1
Sequence:CCGGGAGCGTACTGTAACTGGAGAACTCGAGTTCTCCAGTTACAGTACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-719s1c1
Sequence:CCGGCCGTTTATTCATTGTACTGATCTCGAGATCAGTACAATGAATAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-618s1c1
Sequence:CCGGCGTATTGGATAGCAATGAATACTCGAGTATTCATTGCTATCCAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-1016s1c1
Sequence:CCGGGACTTTAATCCATTTGGTGAACTCGAGTTCACCAAATGGATTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-1009s1c1
Sequence:CCGGGCTCATTGACTTTAATCCATTCTCGAGAATGGATTAAAGTCAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-1081s1c1
Sequence:CCGGGAACAACTTAAACGGCGATTTCTCGAGAAATCGCCGTTTAAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-744s1c1
Sequence:CCGGCTCCAGATCCATGTATAGAATCTCGAGATTCTATACATGGATCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-1079s1c1
Sequence:CCGGGAGAACAACTTAAACGGCGATCTCGAGATCGCCGTTTAAGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-576s1c1
Sequence:CCGGGCAGTGTCTTTCCTAAGCTTACTCGAGTAAGCTTAGGAAAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-691s1c1
Sequence:CCGGCGATTTCATCACTCGTGACTTCTCGAGAAGTCACGAGTGATGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-1178s1c1
Sequence:CCGGCCCTATTTGAGTTACCGGCTACTCGAGTAGCCGGTAACTCAAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-1234s1c1
Sequence:CCGGCGCTCACAAGCTAATAGACTTCTCGAGAAGTCTATTAGCTTGTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006023
VALIDATED
CDC123 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 123
Human
22 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006023.1-331s21c1
Sequence:CCGGCTTCCGAGGCGTTACCATCAACTCGAGTTGATGGTAACGCCTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-865s21c1
Sequence:CCGGCACACAATACTATGATCATATCTCGAGATATGATCATAGTATTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-939s21c1
Sequence:CCGGACATACAGTACAAATTCTTAGCTCGAGCTAAGAATTTGTACTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-746s21c1
Sequence:CCGGCCAGATCCATGTATAGAATATCTCGAGATATTCTATACATGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-1057s21c1
Sequence:CCGGCACCTGGGAAGAACTGATATCCTCGAGGATATCAGTTCTTCCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-547s21c1
Sequence:CCGGAGTCCAGGAACCTATCAATTCCTCGAGGAATTGATAGGTTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-1133s21c1
Sequence:CCGGCCAGCTTTCCGTTGCACAAACCTCGAGGTTTGTGCAACGGAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-964s21c1
Sequence:CCGGAGACTTTGTGTTCGATATATACTCGAGTATATATCGAACACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-509s21c1
Sequence:CCGGACGCTTACGGCACCAGAATTTCTCGAGAAATTCTGGTGCCGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006023.1-372s21c1
Sequence:CCGGCTCAGAATGTGAAGGATTATTCTCGAGAATAATCCTTCACATTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-1293s1c1
Sequence:CCGGGAGCGTACTGTAACTGGAGAACTCGAGTTCTCCAGTTACAGTACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-719s1c1
Sequence:CCGGCCGTTTATTCATTGTACTGATCTCGAGATCAGTACAATGAATAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-618s1c1
Sequence:CCGGCGTATTGGATAGCAATGAATACTCGAGTATTCATTGCTATCCAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-1016s1c1
Sequence:CCGGGACTTTAATCCATTTGGTGAACTCGAGTTCACCAAATGGATTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-1009s1c1
Sequence:CCGGGCTCATTGACTTTAATCCATTCTCGAGAATGGATTAAAGTCAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-1081s1c1
Sequence:CCGGGAACAACTTAAACGGCGATTTCTCGAGAAATCGCCGTTTAAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-744s1c1
Sequence:CCGGCTCCAGATCCATGTATAGAATCTCGAGATTCTATACATGGATCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-1079s1c1
Sequence:CCGGGAGAACAACTTAAACGGCGATCTCGAGATCGCCGTTTAAGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-576s1c1
Sequence:CCGGGCAGTGTCTTTCCTAAGCTTACTCGAGTAAGCTTAGGAAAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006023.1-691s1c1
Sequence:CCGGCGATTTCATCACTCGTGACTTCTCGAGAAGTCACGAGTGATGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-1178s1c1
Sequence:CCGGCCCTATTTGAGTTACCGGCTACTCGAGTAGCCGGTAACTCAAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006023.1-1234s1c1
Sequence:CCGGCGCTCACAAGCTAATAGACTTCTCGAGAAGTCTATTAGCTTGTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133837
VALIDATED
CDC123 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 123
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133837.4-734s1c1
Sequence:CCGGGAAGACTTTGTGTTCGATATACTCGAGTATATCGAACACAAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133837.4-782s1c1
Sequence:CCGGCTCATTGACTTTAATCCATTTCTCGAGAAATGGATTAAAGTCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-319s21c1
Sequence:CCGGAGTCCAAGAAGCTATCAATTCCTCGAGGAATTGATAGCTTCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-782s21c1
Sequence:CCGGCTCATTGACTTTAATCCATTTCTCGAGAAATGGATTAAAGTCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-736s21c1
Sequence:CCGGAGACTTTGTGTTCGATATATACTCGAGTATATATCGAACACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-1201s21c1
Sequence:CCGGAGGGCCTTTGGTACTTGTAAACTCGAGTTTACAAGTACCAAAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-479s21c1
Sequence:CCGGGACTTCACACAGCCGTTTATTCTCGAGAATAAACGGCTGTGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133837.2-108s1c1
Sequence:CCGGCGAAGCCTTACCATCAAGAGTCTCGAGACTCTTGATGGTAAGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133837
VALIDATED
CDC123 MISSION shRNA shRNA Plasmid DNA
cell division cycle 123
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133837.4-734s1c1
Sequence:CCGGGAAGACTTTGTGTTCGATATACTCGAGTATATCGAACACAAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133837.4-782s1c1
Sequence:CCGGCTCATTGACTTTAATCCATTTCTCGAGAAATGGATTAAAGTCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-319s21c1
Sequence:CCGGAGTCCAAGAAGCTATCAATTCCTCGAGGAATTGATAGCTTCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-782s21c1
Sequence:CCGGCTCATTGACTTTAATCCATTTCTCGAGAAATGGATTAAAGTCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-736s21c1
Sequence:CCGGAGACTTTGTGTTCGATATATACTCGAGTATATATCGAACACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-1201s21c1
Sequence:CCGGAGGGCCTTTGGTACTTGTAAACTCGAGTTTACAAGTACCAAAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-479s21c1
Sequence:CCGGGACTTCACACAGCCGTTTATTCTCGAGAATAAACGGCTGTGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133837.2-108s1c1
Sequence:CCGGCGAAGCCTTACCATCAAGAGTCTCGAGACTCTTGATGGTAAGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133837
VALIDATED
CDC123 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 123
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133837.4-734s1c1
Sequence:CCGGGAAGACTTTGTGTTCGATATACTCGAGTATATCGAACACAAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133837.4-782s1c1
Sequence:CCGGCTCATTGACTTTAATCCATTTCTCGAGAAATGGATTAAAGTCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-319s21c1
Sequence:CCGGAGTCCAAGAAGCTATCAATTCCTCGAGGAATTGATAGCTTCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-782s21c1
Sequence:CCGGCTCATTGACTTTAATCCATTTCTCGAGAAATGGATTAAAGTCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-736s21c1
Sequence:CCGGAGACTTTGTGTTCGATATATACTCGAGTATATATCGAACACAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-1201s21c1
Sequence:CCGGAGGGCCTTTGGTACTTGTAAACTCGAGTTTACAAGTACCAAAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133837.4-479s21c1
Sequence:CCGGGACTTCACACAGCCGTTTATTCTCGAGAATAAACGGCTGTGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133837.2-108s1c1
Sequence:CCGGCGAAGCCTTACCATCAAGAGTCTCGAGACTCTTGATGGTAAGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks