EMAIL THIS PAGE TO A FRIEND

CDC14A

cell division cycle 14A

268 Gene Product Result for
Synonyms: cdc14 hCDC14
Gene ID:
Human(8556) Summary: The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. It is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, suggesting a role in cell cycle control. This protein has been shown to interact with, and dephosphorylate tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splicing of this gene results in several transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(229776) CDC14 cell division cycle 14A
Rat(310806) cell division cycle 14A
chicken(424466) CDC14 cell division cycle 14 homolog A (S. cerevisiae)
dog(479926) CDC14 cell division cycle 14 homolog A (S. cerevisiae)
domestic cat(101088601) CDC14 cell division cycle 14 homolog A (S. cerevisiae)
cow(614777) cell division cycle 14A
Horse(100055766) CDC14 cell division cycle 14 homolog A (S. cerevisiae)
sheep(101121483) CDC14 cell division cycle 14 homolog A (S. cerevisiae)
Domestic Rabbit(100346294) CDC14 cell division cycle 14 homolog A (S. cerevisiae)
domestic guinea pig(100722401) cell division cycle 14A
naked mole-rat(101724071) cell division cycle 14A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW21520 Anti-CDC14 (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
GW21521 Anti-CDC14 (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
GW21522 Anti-CDC14 (ab3) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1306533 ANTI-CDC14 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing
SAB1406685 Anti-CDC14A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA023783 Anti-CDC14A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
C2238 Monoclonal Anti-Cdc14A antibody produced in mouse ~2 mg/mL, clone DCS-291, purified immunoglobulin, buffered aqueous solution human
ELISA, immunocytochemistry, immunoprecipitation, microarray, western blot pricing
WH0008556M1 Monoclonal Anti-CDC14A antibody produced in mouse clone 2C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404598 Monoclonal Anti-CDC14A antibody produced in mouse clone 1F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003672 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_149387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_149387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_149387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003672 Rosetta Predictions human pricing
NM_033312 Rosetta Predictions human pricing
NM_033313 Rosetta Predictions human pricing
NM_001107718 Rosetta Predictions rat pricing
NM_001134856 Rosetta Predictions rat pricing
NM_001080818 Rosetta Predictions mouse pricing
XM_149387 Rosetta Predictions mouse pricing
XM_901210 Rosetta Predictions mouse pricing
XM_901214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336067 predicted 1152
2 SASI_Hs02_00336068 predicted 1338
3 SASI_Hs01_00132334 predicted 572
4 SASI_Hs02_00336069 predicted 894
5 SASI_Hs02_00336070 predicted 1354
6 SASI_Hs02_00336071 predicted 976
7 SASI_Hs02_00336072 predicted 1314
8 SASI_Hs02_00336073 predicted 969
9 SASI_Hs02_00336074 predicted 1213
10 SASI_Hs02_00336075 predicted 666
11 SASI_Hs01_00132335 predicted 762
12 SASI_Hs01_00132336 predicted 649
13 SASI_Hs01_00132337 predicted 769
14 SASI_Hs01_00132338 predicted 499
15 SASI_Hs01_00132339 predicted 860
16 SASI_Hs01_00132340 predicted 651
17 SASI_Hs01_00132341 predicted 785
18 SASI_Hs01_00132342 predicted 505
19 SASI_Hs01_00132343 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078462 predicted 1147
2 SASI_Hs01_00078463 predicted 1341
3 SASI_Hs01_00078464 predicted 568
4 SASI_Hs01_00078465 predicted 899
5 SASI_Hs01_00078466 predicted 1351
6 SASI_Hs01_00078469 predicted 981
7 SASI_Hs01_00078470 predicted 1311
8 SASI_Hs01_00078471 predicted 965
9 SASI_Hs02_00361152 predicted 1215
10 SASI_Hs02_00361153 predicted 662
11 SASI_Hs01_00078467 predicted 895
12 SASI_Hs01_00078468 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361154 predicted 1148
2 SASI_Hs02_00361155 predicted 1344
3 SASI_Hs01_00216903 predicted 577
4 SASI_Hs02_00361156 predicted 893
5 SASI_Hs02_00361157 predicted 1352
6 SASI_Hs02_00361158 predicted 978
7 SASI_Hs02_00361159 predicted 1318
8 SASI_Hs02_00361160 predicted 970
9 SASI_Hs02_00361161 predicted 1214
10 SASI_Hs02_00361162 predicted 663
11 SASI_Hs01_00216904 predicted 763
12 SASI_Hs01_00216905 predicted 647
13 SASI_Hs01_00216906 predicted 762
14 SASI_Hs01_00216907 predicted 494
15 SASI_Hs01_00216908 predicted 858
16 SASI_Hs01_00216909 predicted 650
17 SASI_Hs01_00216910 predicted 776
18 SASI_Hs01_00216911 predicted 502
19 SASI_Hs01_00216912 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231585 predicted 1282
2 SASI_Rn02_00231586 predicted 2025
3 SASI_Rn02_00231587 predicted 1864
4 SASI_Rn02_00231588 predicted 1715
5 SASI_Rn02_00231589 predicted 704
6 SASI_Rn02_00231590 predicted 1400
7 SASI_Rn02_00231591 predicted 1487
8 SASI_Rn02_00231592 predicted 1519
9 SASI_Rn02_00231593 predicted 900
10 SASI_Rn02_00231594 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258764 predicted 1207
2 SASI_Rn02_00258765 predicted 1958
3 SASI_Rn02_00258766 predicted 1797
4 SASI_Rn02_00258767 predicted 1642
5 SASI_Rn02_00258768 predicted 630
6 SASI_Rn02_00258769 predicted 1318
7 SASI_Rn02_00258770 predicted 1411
8 SASI_Rn02_00258771 predicted 1451
9 SASI_Rn02_00258772 predicted 831
10 SASI_Rn02_00258773 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293913 predicted 1173
2 SASI_Mm02_00293914 predicted 1141
3 SASI_Mm02_00293915 predicted 984
4 SASI_Mm02_00293916 predicted 977
5 SASI_Mm02_00293917 predicted 1827
6 SASI_Mm02_00293918 predicted 631
7 SASI_Mm02_00293919 predicted 729
8 SASI_Mm02_00293920 predicted 578
9 SASI_Mm02_00293921 predicted 2451
10 SASI_Mm02_00293922 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_149387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228299 predicted 1022
2 SASI_Mm01_00228300 predicted 1706
3 SASI_Mm01_00228301 predicted 987
4 SASI_Mm01_00228302 predicted 1674
5 SASI_Mm01_00228303 predicted 628
6 SASI_Mm01_00228304 predicted 570
7 SASI_Mm01_00228305 predicted 1254
8 SASI_Mm01_00228306 predicted 839
9 SASI_Mm01_00228307 predicted 1177
10 SASI_Mm01_00228308 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901210 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262827 predicted 826
2 SASI_Mm01_00262828 predicted 572
3 SASI_Mm01_00262829 predicted 792
4 SASI_Mm01_00262830 predicted 901
5 SASI_Mm01_00262831 predicted 624
6 SASI_Mm01_00262832 predicted 724
7 SASI_Mm01_00262833 predicted 573
8 SASI_Mm01_00262834 predicted 585
9 SASI_Mm01_00262835 predicted 811
10 SASI_Mm01_00262836 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281270 predicted 575
2 SASI_Mm01_00281271 predicted 625
3 SASI_Mm01_00281272 predicted 576
4 SASI_Mm01_00281273 predicted 610
5 SASI_Mm01_00281274 predicted 584
6 SASI_Mm01_00281275 predicted 578
7 SASI_Mm01_00281276 predicted 579
8 SASI_Mm01_00281277 predicted 574
9 SASI_Mm01_00281278 predicted 579
10 SASI_Mm01_00281279 predicted 631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003672
VALIDATED
CDC14A MISSION shRNA Bacterial Glycerol Stock
cell division cycle 14A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003672.x-2428s1c1
Sequence:CCGGGACTACTATAAATGCACTGAACTCGAGTTCAGTGCATTTATAGTAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003672.x-1586s1c1
Sequence:CCGGTGGAACGATTTGGAGAGGATACTCGAGTATCCTCTCCAAATCGTTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003672.x-1505s1c1
Sequence:CCGGCCAGTGAAGGAAGTATTAATACTCGAGTATTAATACTTCCTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003672.x-2028s1c1
Sequence:CCGGCCAGCCAACTACCAGAAATTACTCGAGTAATTTCTGGTAGTTGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003672.x-885s1c1
Sequence:CCGGTCTCACCATTCTCGACTGTTTCTCGAGAAACAGTCGAGAATGGTGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003672.3-2220s21c1
Sequence:GTACCGGAGATTCCTGAGCCGTTCTATCCTCGAGGATAGAACGGCTCAGGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003672.3-1560s21c1
Sequence:GTACCGGGGCCTAGATGATATGTCTATTCTCGAGAATAGACATATCATCTAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003672.3-2051s21c1
Sequence:CCGGCCAGCCAACTACCAGAAATTACTCGAGTAATTTCTGGTAGTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003672.3-2451s21c1
Sequence:CCGGGACTACTATAAATGCACTGAACTCGAGTTCAGTGCATTTATAGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003672.3-789s21c1
Sequence:CCGGGCCTATGCAGTAATCTATTTACTCGAGTAAATAGATTACTGCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003672.3-1528s21c1
Sequence:CCGGCCAGTGAAGGAAGTATTAATACTCGAGTATTAATACTTCCTTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003672
VALIDATED
CDC14A MISSION shRNA shRNA Plasmid DNA
cell division cycle 14A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003672.x-2428s1c1
Sequence:CCGGGACTACTATAAATGCACTGAACTCGAGTTCAGTGCATTTATAGTAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003672.x-1586s1c1
Sequence:CCGGTGGAACGATTTGGAGAGGATACTCGAGTATCCTCTCCAAATCGTTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003672.x-1505s1c1
Sequence:CCGGCCAGTGAAGGAAGTATTAATACTCGAGTATTAATACTTCCTTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003672.x-2028s1c1
Sequence:CCGGCCAGCCAACTACCAGAAATTACTCGAGTAATTTCTGGTAGTTGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003672.x-885s1c1
Sequence:CCGGTCTCACCATTCTCGACTGTTTCTCGAGAAACAGTCGAGAATGGTGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003672.3-2220s21c1
Sequence:GTACCGGAGATTCCTGAGCCGTTCTATCCTCGAGGATAGAACGGCTCAGGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003672.3-1560s21c1
Sequence:GTACCGGGGCCTAGATGATATGTCTATTCTCGAGAATAGACATATCATCTAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003672.3-2051s21c1
Sequence:CCGGCCAGCCAACTACCAGAAATTACTCGAGTAATTTCTGGTAGTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003672.3-2451s21c1
Sequence:CCGGGACTACTATAAATGCACTGAACTCGAGTTCAGTGCATTTATAGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003672.3-789s21c1
Sequence:CCGGGCCTATGCAGTAATCTATTTACTCGAGTAAATAGATTACTGCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003672.3-1528s21c1
Sequence:CCGGCCAGTGAAGGAAGTATTAATACTCGAGTATTAATACTTCCTTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003672
VALIDATED
CDC14A MISSION shRNA Lentiviral Transduction Particles
cell division cycle 14A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003672.x-2428s1c1
Sequence:CCGGGACTACTATAAATGCACTGAACTCGAGTTCAGTGCATTTATAGTAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003672.x-1586s1c1
Sequence:CCGGTGGAACGATTTGGAGAGGATACTCGAGTATCCTCTCCAAATCGTTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003672.x-1505s1c1
Sequence:CCGGCCAGTGAAGGAAGTATTAATACTCGAGTATTAATACTTCCTTCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003672.x-2028s1c1
Sequence:CCGGCCAGCCAACTACCAGAAATTACTCGAGTAATTTCTGGTAGTTGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003672.x-885s1c1
Sequence:CCGGTCTCACCATTCTCGACTGTTTCTCGAGAAACAGTCGAGAATGGTGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003672.3-2220s21c1
Sequence:GTACCGGAGATTCCTGAGCCGTTCTATCCTCGAGGATAGAACGGCTCAGGAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003672.3-1560s21c1
Sequence:GTACCGGGGCCTAGATGATATGTCTATTCTCGAGAATAGACATATCATCTAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003672.3-2051s21c1
Sequence:CCGGCCAGCCAACTACCAGAAATTACTCGAGTAATTTCTGGTAGTTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003672.3-2451s21c1
Sequence:CCGGGACTACTATAAATGCACTGAACTCGAGTTCAGTGCATTTATAGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003672.3-789s21c1
Sequence:CCGGGCCTATGCAGTAATCTATTTACTCGAGTAAATAGATTACTGCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003672.3-1528s21c1
Sequence:CCGGCCAGTGAAGGAAGTATTAATACTCGAGTATTAATACTTCCTTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_149387
CDC14A MISSION shRNA Bacterial Glycerol Stock
cell division cycle 14A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149387.5-1567s1c1
Sequence:CCGGCCATCCAGTGAGGGAAGTATTCTCGAGAATACTTCCCTCACTGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149387.5-1386s1c1
Sequence:CCGGCGGGACATTGATAGCCTGTTACTCGAGTAACAGGCTATCAATGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149387.5-1162s1c1
Sequence:CCGGGCCTACTTTCCATACTTCAAACTCGAGTTTGAAGTATGGAAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149387.5-566s1c1
Sequence:CCGGGCGAGTTCATGAAAGATCGATCTCGAGATCGATCTTTCATGAACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_149387.5-3217s1c1
Sequence:CCGGGCCTTCTTGTAAATATGCAAACTCGAGTTTGCATATTTACAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_149387
CDC14A MISSION shRNA shRNA Plasmid DNA
cell division cycle 14A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149387.5-1567s1c1
Sequence:CCGGCCATCCAGTGAGGGAAGTATTCTCGAGAATACTTCCCTCACTGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149387.5-1386s1c1
Sequence:CCGGCGGGACATTGATAGCCTGTTACTCGAGTAACAGGCTATCAATGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149387.5-1162s1c1
Sequence:CCGGGCCTACTTTCCATACTTCAAACTCGAGTTTGAAGTATGGAAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149387.5-566s1c1
Sequence:CCGGGCGAGTTCATGAAAGATCGATCTCGAGATCGATCTTTCATGAACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_149387.5-3217s1c1
Sequence:CCGGGCCTTCTTGTAAATATGCAAACTCGAGTTTGCATATTTACAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_149387
CDC14A MISSION shRNA Lentiviral Transduction Particles
cell division cycle 14A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149387.5-1567s1c1
Sequence:CCGGCCATCCAGTGAGGGAAGTATTCTCGAGAATACTTCCCTCACTGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149387.5-1386s1c1
Sequence:CCGGCGGGACATTGATAGCCTGTTACTCGAGTAACAGGCTATCAATGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149387.5-1162s1c1
Sequence:CCGGGCCTACTTTCCATACTTCAAACTCGAGTTTGAAGTATGGAAAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149387.5-566s1c1
Sequence:CCGGGCGAGTTCATGAAAGATCGATCTCGAGATCGATCTTTCATGAACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_149387.5-3217s1c1
Sequence:CCGGGCCTTCTTGTAAATATGCAAACTCGAGTTTGCATATTTACAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)