EMAIL THIS PAGE TO A FRIEND

CDC14B

cell division cycle 14B

Synonyms: CDC14B3 Cdc14B1 Cdc14B2 hCDC14B
Gene ID:
Human(8555) Summary: The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. This protein is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, which suggests the role in cell cycle control. This protein has been shown to interact with and dephosphorylates tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splice of this gene results in 3 transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(218294) CDC14 cell division cycle 14B
Rat(361195) cell division cycle 14B
Zebrafish(393148) CDC14 cell division cycle 14 homolog B
cow(520428) CDC14 cell division cycle 14 homolog B (S. cerevisiae)
Horse(100062379) CDC14 cell division cycle 14 homolog B (S. cerevisiae)
domestic cat(101086096) CDC14 cell division cycle 14 homolog B (S. cerevisiae)
dog(476294) CDC14 cell division cycle 14 homolog B (S. cerevisiae)
chicken(427473) CDC14 cell division cycle 14 homolog B (S. cerevisiae)
naked mole-rat(101713083) cell division cycle 14B
domestic guinea pig(100727486) cell division cycle 14B
sheep(101110906) CDC14 cell division cycle 14 homolog B (S. cerevisiae)
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003671 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077181 Rosetta Predictions human pricing
NM_003671 Rosetta Predictions human pricing
NM_033331 Rosetta Predictions human pricing
NM_001108404 Rosetta Predictions rat pricing
NM_001122989 Rosetta Predictions mouse pricing
NM_172587 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312084 predicted 873
2 SASI_Hs02_00312085 predicted 875
3 SASI_Hs02_00312086 predicted 438
4 SASI_Hs02_00312087 predicted 821
5 SASI_Hs02_00312088 predicted 865
6 SASI_Hs02_00312089 predicted 560
7 SASI_Hs02_00312090 predicted 475
8 SASI_Hs02_00312091 predicted 722
9 SASI_Hs02_00312092 predicted 517
10 SASI_Hs02_00312093 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336057 predicted 1329
2 SASI_Hs02_00336058 predicted 1331
3 SASI_Hs02_00336059 predicted 903
4 SASI_Hs02_00336060 predicted 1274
5 SASI_Hs02_00336061 predicted 1319
6 SASI_Hs02_00336062 predicted 1020
7 SASI_Hs02_00336063 predicted 926
8 SASI_Hs02_00336064 predicted 1181
9 SASI_Hs02_00336065 predicted 977
10 SASI_Hs02_00336066 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020772 predicted 1333
2 SASI_Hs01_00020775 predicted 1337
3 SASI_Hs01_00020776 predicted 899
4 SASI_Hs01_00020778 predicted 1275
5 SASI_Hs01_00020779 predicted 1319
6 SASI_Hs02_00361181 predicted 1014
7 SASI_Hs02_00361182 predicted 924
8 SASI_Hs02_00361183 predicted 1183
9 SASI_Hs02_00361184 predicted 974
10 SASI_Hs02_00361185 predicted 944
11 SASI_Hs01_00020771 predicted 1737
12 SASI_Hs01_00020773 predicted 1698
13 SASI_Hs01_00020774 predicted 1740
14 SASI_Hs01_00020777 predicted 773
15 SASI_Hs01_00020780 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238329 predicted 954
2 SASI_Rn02_00238330 predicted 767
3 SASI_Rn02_00238331 predicted 1052
4 SASI_Rn02_00238332 predicted 740
5 SASI_Rn02_00238333 predicted 623
6 SASI_Rn02_00238334 predicted 1373
7 SASI_Rn02_00238335 predicted 385
8 SASI_Rn02_00238336 predicted 660
9 SASI_Rn02_00238337 predicted 1401
10 SASI_Rn02_00238338 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122989 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309729 predicted 578
2 SASI_Mm02_00309730 predicted 1156
3 SASI_Mm02_00309731 predicted 1463
4 SASI_Mm02_00309732 predicted 940
5 SASI_Mm02_00309733 predicted 700
6 SASI_Mm02_00309734 predicted 420
7 SASI_Mm02_00309735 predicted 734
8 SASI_Mm02_00309736 predicted 851
9 SASI_Mm02_00309737 predicted 560
10 SASI_Mm02_00309738 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344267 predicted 843
2 SASI_Mm01_00046864 predicted 1425
3 SASI_Mm01_00046867 predicted 1730
4 SASI_Mm01_00046865 predicted 1200
5 SASI_Mm01_00046866 predicted 971
6 SASI_Mm01_00046868 predicted 680
7 SASI_Mm01_00046869 predicted 1001
8 SASI_Mm02_00344268 predicted 1108
9 SASI_Mm01_00046870 predicted 825
10 SASI_Mm01_00046871 predicted 1478
11 SASI_Mm01_00046863 predicted 665
12 SASI_Mm01_00046872 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003671
VALIDATED
CDC14B MISSION shRNA Bacterial Glycerol Stock
cell division cycle 14B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003671.3-1735s21c1
Sequence:GTACCGGGTGATAGACTTCGGGCCTTGACTCGAGTCAAGGCCCGAAGTCTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003671.3-2315s21c1
Sequence:CCGGATCATCTTCACTTGACTATTTCTCGAGAAATAGTCAAGTGAAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003671.3-1105s21c1
Sequence:CCGGGGATAATACCAGACCGATTTACTCGAGTAAATCGGTCTGGTATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003671.3-1183s21c1
Sequence:CCGGCTCCTGAGACTTATATTCAATCTCGAGATTGAATATAAGTCTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003671.3-1215s21c1
Sequence:CCGGCACAATGTTACTACCATTATTCTCGAGAATAATGGTAGTAACATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003671.3-859s21c1
Sequence:CCGGTTGGATGCTACATGGTTATATCTCGAGATATAACCATGTAGCATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003671.3-1326s21c1
Sequence:GTACCGGACTGATGCCATTGTCAAAGAACTCGAGTTCTTTGACAATGGCATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003671.2-1797s1c1
Sequence:CCGGCTCTCCATTTCAAGGACTAAACTCGAGTTTAGTCCTTGAAATGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003671.2-1183s1c1
Sequence:CCGGCTCCTGAGACTTATATTCAATCTCGAGATTGAATATAAGTCTCAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003671.2-650s1c1
Sequence:CCGGGAGTGCATCAAATGTACATTACTCGAGTAATGTACATTTGATGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003671.2-2700s1c1
Sequence:CCGGCCAAATAATGTCGGCTTACAACTCGAGTTGTAAGCCGACATTATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003671
VALIDATED
CDC14B MISSION shRNA shRNA Plasmid DNA
cell division cycle 14B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003671.3-1735s21c1
Sequence:GTACCGGGTGATAGACTTCGGGCCTTGACTCGAGTCAAGGCCCGAAGTCTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003671.3-2315s21c1
Sequence:CCGGATCATCTTCACTTGACTATTTCTCGAGAAATAGTCAAGTGAAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003671.3-1105s21c1
Sequence:CCGGGGATAATACCAGACCGATTTACTCGAGTAAATCGGTCTGGTATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003671.3-1183s21c1
Sequence:CCGGCTCCTGAGACTTATATTCAATCTCGAGATTGAATATAAGTCTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003671.3-1215s21c1
Sequence:CCGGCACAATGTTACTACCATTATTCTCGAGAATAATGGTAGTAACATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003671.3-859s21c1
Sequence:CCGGTTGGATGCTACATGGTTATATCTCGAGATATAACCATGTAGCATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003671.3-1326s21c1
Sequence:GTACCGGACTGATGCCATTGTCAAAGAACTCGAGTTCTTTGACAATGGCATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003671.2-1797s1c1
Sequence:CCGGCTCTCCATTTCAAGGACTAAACTCGAGTTTAGTCCTTGAAATGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003671.2-1183s1c1
Sequence:CCGGCTCCTGAGACTTATATTCAATCTCGAGATTGAATATAAGTCTCAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003671.2-650s1c1
Sequence:CCGGGAGTGCATCAAATGTACATTACTCGAGTAATGTACATTTGATGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003671.2-2700s1c1
Sequence:CCGGCCAAATAATGTCGGCTTACAACTCGAGTTGTAAGCCGACATTATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003671
VALIDATED
CDC14B MISSION shRNA Lentiviral Transduction Particles
cell division cycle 14B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003671.3-1735s21c1
Sequence:GTACCGGGTGATAGACTTCGGGCCTTGACTCGAGTCAAGGCCCGAAGTCTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003671.3-2315s21c1
Sequence:CCGGATCATCTTCACTTGACTATTTCTCGAGAAATAGTCAAGTGAAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003671.3-1105s21c1
Sequence:CCGGGGATAATACCAGACCGATTTACTCGAGTAAATCGGTCTGGTATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003671.3-1183s21c1
Sequence:CCGGCTCCTGAGACTTATATTCAATCTCGAGATTGAATATAAGTCTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003671.3-1215s21c1
Sequence:CCGGCACAATGTTACTACCATTATTCTCGAGAATAATGGTAGTAACATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003671.3-859s21c1
Sequence:CCGGTTGGATGCTACATGGTTATATCTCGAGATATAACCATGTAGCATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003671.3-1326s21c1
Sequence:GTACCGGACTGATGCCATTGTCAAAGAACTCGAGTTCTTTGACAATGGCATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003671.2-1797s1c1
Sequence:CCGGCTCTCCATTTCAAGGACTAAACTCGAGTTTAGTCCTTGAAATGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003671.2-1183s1c1
Sequence:CCGGCTCCTGAGACTTATATTCAATCTCGAGATTGAATATAAGTCTCAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003671.2-650s1c1
Sequence:CCGGGAGTGCATCAAATGTACATTACTCGAGTAATGTACATTTGATGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003671.2-2700s1c1
Sequence:CCGGCCAAATAATGTCGGCTTACAACTCGAGTTGTAAGCCGACATTATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172587
CDC14B MISSION shRNA Bacterial Glycerol Stock
cell division cycle 14B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-577s1c1
Sequence:CCGGGCCTTCCTTATCGGGTGTTATCTCGAGATAACACCCGATAAGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-1417s1c1
Sequence:CCGGCCTGAGCCGTATAGTGATGATCTCGAGATCATCACTATACGGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-414s1c1
Sequence:CCGGCGAGCTAGAGTATGAGAACTTCTCGAGAAGTTCTCATACTCTAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-1245s1c1
Sequence:CCGGCCAGCAACAGTTTCTGGTCATCTCGAGATGACCAGAAACTGTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-1006s1c1
Sequence:CCGGGCTGGATTCGATCACCATGATCTCGAGATCATGGTGATCGAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172587
CDC14B MISSION shRNA shRNA Plasmid DNA
cell division cycle 14B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-577s1c1
Sequence:CCGGGCCTTCCTTATCGGGTGTTATCTCGAGATAACACCCGATAAGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-1417s1c1
Sequence:CCGGCCTGAGCCGTATAGTGATGATCTCGAGATCATCACTATACGGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-414s1c1
Sequence:CCGGCGAGCTAGAGTATGAGAACTTCTCGAGAAGTTCTCATACTCTAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-1245s1c1
Sequence:CCGGCCAGCAACAGTTTCTGGTCATCTCGAGATGACCAGAAACTGTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-1006s1c1
Sequence:CCGGGCTGGATTCGATCACCATGATCTCGAGATCATGGTGATCGAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172587
CDC14B MISSION shRNA Lentiviral Transduction Particles
cell division cycle 14B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-577s1c1
Sequence:CCGGGCCTTCCTTATCGGGTGTTATCTCGAGATAACACCCGATAAGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-1417s1c1
Sequence:CCGGCCTGAGCCGTATAGTGATGATCTCGAGATCATCACTATACGGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-414s1c1
Sequence:CCGGCGAGCTAGAGTATGAGAACTTCTCGAGAAGTTCTCATACTCTAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-1245s1c1
Sequence:CCGGCCAGCAACAGTTTCTGGTCATCTCGAGATGACCAGAAACTGTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172587.2-1006s1c1
Sequence:CCGGGCTGGATTCGATCACCATGATCTCGAGATCATGGTGATCGAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks