EMAIL THIS PAGE TO A FRIEND

CDC14C

cell division cycle 14C

29 Gene Product Result for
Synonyms: CDC14B2 CDC14Bretro
Species: Human CDC14C(168448)
UniProtKB ID: A4D256, Q2VIP7, Q6NUS3, Q8NCT2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152627 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003595 Rosetta Predictions human pricing
XM_498195 Rosetta Predictions human pricing
XM_930629 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379765 predicted 1291
2 SASI_Hs02_00379766 predicted 1260
3 SASI_Hs02_00379767 predicted 1383
4 SASI_Hs02_00379768 predicted 2543
5 SASI_Hs02_00379769 predicted 1377
6 SASI_Hs02_00379770 predicted 1491
7 SASI_Hs02_00379771 predicted 1385
8 SASI_Hs02_00379772 predicted 1399
9 SASI_Hs02_00379773 predicted 1646
10 SASI_Hs02_00379774 predicted 1653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_498195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249088 predicted 1317
2 SASI_Hs01_00249089 predicted 1510
3 SASI_Hs01_00249090 predicted 136
4 SASI_Hs01_00249091 predicted 139
5 SASI_Hs01_00249092 predicted 1476
6 SASI_Hs01_00249093 predicted 1592
7 SASI_Hs01_00249094 predicted 1594
8 SASI_Hs01_00249095 predicted 1589
9 SASI_Hs01_00249096 predicted 1608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272759 predicted 1513
2 SASI_Hs01_00272760 predicted 1309
3 SASI_Hs01_00272761 predicted 1277
4 SASI_Hs01_00272762 predicted 1401
5 SASI_Hs01_00272763 predicted 1400
6 SASI_Hs01_00272764 predicted 1388
7 SASI_Hs01_00272765 predicted 1405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152627
CDC14C MISSION shRNA Bacterial Glycerol Stock
cell division cycle 14C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1340s1c1
Sequence:CCGGCAAACGATATTCTTCTCCCATCTCGAGATGGGAGAAGAATATCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1404s1c1
Sequence:CCGGCTGGTGGATTGTTTGTGACTACTCGAGTAGTCACAAACAATCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1648s1c1
Sequence:CCGGCCACCTAAGAAGCTAATCAATCTCGAGATTGATTAGCTTCTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1388s1c1
Sequence:CCGGTGTGTAGTGTTGTCATCTGGTCTCGAGACCAGATGACAACACTACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1240s1c1
Sequence:CCGGGACCAGCAAGAACCCAAACCTCTCGAGAGGTTTGGGTTCTTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152627
CDC14C MISSION shRNA shRNA Plasmid DNA
cell division cycle 14C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1340s1c1
Sequence:CCGGCAAACGATATTCTTCTCCCATCTCGAGATGGGAGAAGAATATCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1404s1c1
Sequence:CCGGCTGGTGGATTGTTTGTGACTACTCGAGTAGTCACAAACAATCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1648s1c1
Sequence:CCGGCCACCTAAGAAGCTAATCAATCTCGAGATTGATTAGCTTCTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1388s1c1
Sequence:CCGGTGTGTAGTGTTGTCATCTGGTCTCGAGACCAGATGACAACACTACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1240s1c1
Sequence:CCGGGACCAGCAAGAACCCAAACCTCTCGAGAGGTTTGGGTTCTTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152627
CDC14C MISSION shRNA Lentiviral Transduction Particles
cell division cycle 14C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1340s1c1
Sequence:CCGGCAAACGATATTCTTCTCCCATCTCGAGATGGGAGAAGAATATCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1404s1c1
Sequence:CCGGCTGGTGGATTGTTTGTGACTACTCGAGTAGTCACAAACAATCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1648s1c1
Sequence:CCGGCCACCTAAGAAGCTAATCAATCTCGAGATTGATTAGCTTCTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1388s1c1
Sequence:CCGGTGTGTAGTGTTGTCATCTGGTCTCGAGACCAGATGACAACACTACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152627.1-1240s1c1
Sequence:CCGGGACCAGCAAGAACCCAAACCTCTCGAGAGGTTTGGGTTCTTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks