EMAIL THIS PAGE TO A FRIEND

CDC16

cell division cycle 16

80 Gene Product Result for
Synonyms: ANAPC6 APC6 CUT9
UniProtKB ID: Q13042, A2A365, Q5T8C8, Q96AE6, Q9Y564
Gene ID:
Human(8881) Summary: This gene encodes a component protein of the APC complex, which is composed of eight proteins and functions as a protein ubiquitin ligase. The APC complex is a cyclin degradation system that governs exit from mitosis. Each component protein of the APC complex is highly conserved among eukaryotic organisms. This protein and two other APC complex proteins, CDC23 and CDC27, contain a tetratricopeptide repeat (TPR), a protein domain that may be involved in protein-protein interaction. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(69957) CDC16 cell division cycle 16
Rat(290875) cell division cycle 16
Zebrafish(562014) cell division cycle 16 homolog (S. cerevisiae)
cow(614342) cell division cycle 16 homolog (S. cerevisiae)
Horse(100069285) cell division cycle 16 homolog (S. cerevisiae)
domestic cat(101092821) cell division cycle 16 homolog (S. cerevisiae)
dog(607100) cell division cycle 16 homolog (S. cerevisiae)
fruit fly(42753) CG6759 gene product from transcript CG6759-RA
chicken(418735) cell division cycle 16 homolog (S. cerevisiae)
sheep(101117773) cell division cycle 16 homolog (S. cerevisiae)
Domestic Rabbit(100359101) cell division cycle 16 homolog (S. cerevisiae)
domestic guinea pig(100725418) cell division cycle 16
naked mole-rat(101724017) cell division cycle 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003903 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027276 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027276 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027276 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001078645 Rosetta Predictions human pricing
NM_003903 Rosetta Predictions human pricing
NM_001024744 Rosetta Predictions rat pricing
NM_027276 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313339 predicted 1276
2 SASI_Hs02_00313340 predicted 1184
3 SASI_Hs02_00313341 predicted 897
4 SASI_Hs02_00313342 predicted 1640
5 SASI_Hs02_00313343 predicted 1494
6 SASI_Hs02_00313344 predicted 635
7 SASI_Hs02_00313345 predicted 1064
8 SASI_Hs02_00313346 predicted 270
9 SASI_Hs02_00313347 predicted 1300
10 SASI_Hs02_00313348 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089159 predicted 1275
2 SASI_Hs01_00089160 predicted 1190
3 SASI_Hs01_00089161 predicted 895
4 SASI_Hs01_00089162 predicted 1640
5 SASI_Hs01_00089164 predicted 1490
6 SASI_Hs01_00089165 predicted 643
7 SASI_Hs01_00089166 predicted 1069
8 SASI_Hs02_00336530 predicted 270
9 SASI_Hs01_00089167 predicted 1301
10 SASI_Hs01_00089168 predicted 1215
11 SASI_Hs01_00089163 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102796 predicted 374
2 SASI_Rn01_00102798 predicted 1408
3 SASI_Rn01_00102799 predicted 998
4 SASI_Rn01_00102800 predicted 991
5 SASI_Rn01_00102801 predicted 1633
6 SASI_Rn01_00102802 predicted 1244
7 SASI_Rn01_00102803 predicted 1542
8 SASI_Rn01_00102804 predicted 1916
9 SASI_Rn01_00102805 predicted 397
10 SASI_Rn02_00202617 predicted 979
11 SASI_Rn01_00102797 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190898 predicted 1440
2 SASI_Mm01_00190899 predicted 1415
3 SASI_Mm01_00190900 predicted 1221
4 SASI_Mm01_00190902 predicted 1213
5 SASI_Mm01_00190903 predicted 981
6 SASI_Mm01_00190904 predicted 501
7 SASI_Mm01_00190905 predicted 1652
8 SASI_Mm01_00190906 predicted 1039
9 SASI_Mm01_00190907 predicted 1005
10 SASI_Mm02_00331864 predicted 763
11 SASI_Mm01_00190901 predicted 1730
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003903
CDC16 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 16
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-1342s1c1
Sequence:CCGGGCTGAAAGGTTCTTCAGCCAACTCGAGTTGGCTGAAGAACCTTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-1618s1c1
Sequence:CCGGGCATCCACCTACTCTGCTATTCTCGAGAATAGCAGAGTAGGTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-554s1c1
Sequence:CCGGCACAGTCTTCAATAAAGAGTTCTCGAGAACTCTTTATTGAAGACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-976s1c1
Sequence:CCGGGCAAGTTGTTTACCTGTACATCTCGAGATGTACAGGTAAACAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-235s1c1
Sequence:CCGGCAACAGTATCAAAGTGCTCTACTCGAGTAGAGCACTTTGATACTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003903.3-1018s21c1
Sequence:CCGGACGCTTGTAGAGCTGAATAAACTCGAGTTTATTCAGCTCTACAAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003903.3-1752s21c1
Sequence:CCGGGCTTGGTCATTGCATCGAAATCTCGAGATTTCGATGCAATGACCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003903.3-1720s21c1
Sequence:CCGGCTTAGGCGAGATGATACATTTCTCGAGAAATGTATCATCTCGCCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003903.3-1122s21c1
Sequence:CCGGCTATCTCATGGTCGGTCATAACTCGAGTTATGACCGACCATGAGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003903
CDC16 MISSION shRNA shRNA Plasmid DNA
cell division cycle 16
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-1342s1c1
Sequence:CCGGGCTGAAAGGTTCTTCAGCCAACTCGAGTTGGCTGAAGAACCTTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-1618s1c1
Sequence:CCGGGCATCCACCTACTCTGCTATTCTCGAGAATAGCAGAGTAGGTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-554s1c1
Sequence:CCGGCACAGTCTTCAATAAAGAGTTCTCGAGAACTCTTTATTGAAGACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-976s1c1
Sequence:CCGGGCAAGTTGTTTACCTGTACATCTCGAGATGTACAGGTAAACAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-235s1c1
Sequence:CCGGCAACAGTATCAAAGTGCTCTACTCGAGTAGAGCACTTTGATACTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003903.3-1018s21c1
Sequence:CCGGACGCTTGTAGAGCTGAATAAACTCGAGTTTATTCAGCTCTACAAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003903.3-1752s21c1
Sequence:CCGGGCTTGGTCATTGCATCGAAATCTCGAGATTTCGATGCAATGACCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003903.3-1720s21c1
Sequence:CCGGCTTAGGCGAGATGATACATTTCTCGAGAAATGTATCATCTCGCCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003903.3-1122s21c1
Sequence:CCGGCTATCTCATGGTCGGTCATAACTCGAGTTATGACCGACCATGAGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003903
CDC16 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 16
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-1342s1c1
Sequence:CCGGGCTGAAAGGTTCTTCAGCCAACTCGAGTTGGCTGAAGAACCTTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-1618s1c1
Sequence:CCGGGCATCCACCTACTCTGCTATTCTCGAGAATAGCAGAGTAGGTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-554s1c1
Sequence:CCGGCACAGTCTTCAATAAAGAGTTCTCGAGAACTCTTTATTGAAGACTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-976s1c1
Sequence:CCGGGCAAGTTGTTTACCTGTACATCTCGAGATGTACAGGTAAACAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003903.2-235s1c1
Sequence:CCGGCAACAGTATCAAAGTGCTCTACTCGAGTAGAGCACTTTGATACTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003903.3-1018s21c1
Sequence:CCGGACGCTTGTAGAGCTGAATAAACTCGAGTTTATTCAGCTCTACAAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003903.3-1752s21c1
Sequence:CCGGGCTTGGTCATTGCATCGAAATCTCGAGATTTCGATGCAATGACCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003903.3-1720s21c1
Sequence:CCGGCTTAGGCGAGATGATACATTTCTCGAGAAATGTATCATCTCGCCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003903.3-1122s21c1
Sequence:CCGGCTATCTCATGGTCGGTCATAACTCGAGTTATGACCGACCATGAGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027276
CDC16 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027276.2-2094s1c1
Sequence:CCGGCCAGACTACATCTCTACATTTCTCGAGAAATGTAGAGATGTAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027276.2-1552s1c1
Sequence:CCGGGCATCCACCTACTCTGCTATACTCGAGTATAGCAGAGTAGGTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027276.2-558s1c1
Sequence:CCGGCCTGGCTACCTACAGTTACAACTCGAGTTGTAACTGTAGGTAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027276.2-1719s1c1
Sequence:CCGGCGGAGCAGACATTAAAGACAACTCGAGTTGTCTTTAATGTCTGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027276.2-408s1c1
Sequence:CCGGGCCAATTAACAGAAGGCTCTTCTCGAGAAGAGCCTTCTGTTAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027276
CDC16 MISSION shRNA shRNA Plasmid DNA
cell division cycle 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027276.2-2094s1c1
Sequence:CCGGCCAGACTACATCTCTACATTTCTCGAGAAATGTAGAGATGTAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027276.2-1552s1c1
Sequence:CCGGGCATCCACCTACTCTGCTATACTCGAGTATAGCAGAGTAGGTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027276.2-558s1c1
Sequence:CCGGCCTGGCTACCTACAGTTACAACTCGAGTTGTAACTGTAGGTAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027276.2-1719s1c1
Sequence:CCGGCGGAGCAGACATTAAAGACAACTCGAGTTGTCTTTAATGTCTGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027276.2-408s1c1
Sequence:CCGGGCCAATTAACAGAAGGCTCTTCTCGAGAAGAGCCTTCTGTTAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027276
CDC16 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027276.2-2094s1c1
Sequence:CCGGCCAGACTACATCTCTACATTTCTCGAGAAATGTAGAGATGTAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027276.2-1552s1c1
Sequence:CCGGGCATCCACCTACTCTGCTATACTCGAGTATAGCAGAGTAGGTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027276.2-558s1c1
Sequence:CCGGCCTGGCTACCTACAGTTACAACTCGAGTTGTAACTGTAGGTAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027276.2-1719s1c1
Sequence:CCGGCGGAGCAGACATTAAAGACAACTCGAGTTGTCTTTAATGTCTGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027276.2-408s1c1
Sequence:CCGGGCCAATTAACAGAAGGCTCTTCTCGAGAAGAGCCTTCTGTTAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)