EMAIL THIS PAGE TO A FRIEND

CDC20

cell division cycle 20

64 Gene Product Result for
Synonyms: CDC20A bA276H19.3 p55CDC
UniProtKB ID: Q12834, B2R6Z6, D3DPJ1, Q5JUY4, Q9BW56, Q9UQI9
Gene ID:
Human(991) Summary: CDC20 appears to act as a regulatory protein interacting with several other proteins at multiple points in the cell cycle. It is required for two microtubule-dependent processes, nuclear movement prior to anaphase and chromosome separation. [provided by RefSeq, Jul 2008]
Mouse(107995) cell division cycle 20
Rat(64515) cell division cycle 20
Zebrafish(406353) cell division cycle 20 homolog
cow(281675) cell division cycle 20 homolog (S. cerevisiae)
cow(515376) cell division cycle 20 homolog (S. cerevisiae)
Horse(100053348) cell division cycle 20 homolog (S. cerevisiae)
domestic cat(101097259) cell division cycle 20 homolog (S. cerevisiae)
dog(482534) cell division cycle 20 homolog (S. cerevisiae)
chicken(424563) cell division cycle 20 homolog (S. cerevisiae)
naked mole-rat(101707229) cell division cycle 20
domestic guinea pig(100718545) cell division cycle 20
sheep(101110548) cell division cycle 20 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C5622 Anti-CDC20 (136-150) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C5497 Anti-CDC20 (51-65) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2108277 Anti-CDC20 antibody produced in rabbit affinity isolated antibody human, horse, rat, bovine, mouse, pig, canine
immunohistochemistry, western blot pricing
HPA055288 Anti-CDC20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1411705 Anti-CDC20 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA045842 Anti-CDC20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2103238 Anti-CDC20, (N-terminal) antibody produced in rabbit affinity isolated antibody, lyophilized powder pig, horse, mouse, canine, rat, chicken, bovine, human
western blot pricing
SAB4503731 Anti-p55CDC antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
PLA0173 Rabbit anti-CDC20 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, dog, mouse, horse, pig, gorilla, chimpanzee, human, rhesus monkey, primate, marmoset
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0016 AQUA Peptide ILDAPEI[R] chicken, cow, dog, human, mouse, pig, rat pricing
AQ0017 AQUA Peptide YIPSLPD[R] cow, dog, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001255 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001255 Rosetta Predictions human pricing
NM_171993 Rosetta Predictions rat pricing
NM_023223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214448 predicted 441
2 SASI_Hs01_00214449 predicted 1338
3 SASI_Hs01_00214450 predicted 1358
4 SASI_Hs01_00214451 predicted 863
5 SASI_Hs01_00214452 predicted 274
6 SASI_Hs01_00214453 predicted 1076
7 SASI_Hs01_00214454 predicted 1098
8 SASI_Hs01_00214455 predicted 970
9 SASI_Hs01_00214456 predicted 796
10 SASI_Hs01_00214457 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061976 predicted 426
2 SASI_Rn01_00061977 predicted 209
3 SASI_Rn01_00061978 predicted 1424
4 SASI_Rn01_00061979 predicted 509
5 SASI_Rn01_00061980 predicted 374
6 SASI_Rn01_00061981 predicted 523
7 SASI_Rn01_00061982 predicted 757
8 SASI_Rn02_00269094 predicted 513
9 SASI_Rn01_00061983 predicted 992
10 SASI_Rn01_00061984 predicted 1068
11 SASI_Rn01_00061985 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061048 predicted 402
2 SASI_Mm01_00061049 predicted 773
3 SASI_Mm01_00061051 predicted 1461
4 SASI_Mm01_00061052 predicted 1052
5 SASI_Mm01_00061053 predicted 567
6 SASI_Mm01_00061054 predicted 1037
7 SASI_Mm02_00326977 predicted 1089
8 SASI_Mm02_00326978 predicted 236
9 SASI_Mm01_00061055 predicted 1029
10 SASI_Mm01_00061056 predicted 1453
11 SASI_Mm01_00061050 predicted 468
12 SASI_Mm01_00061057 predicted 966
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001255
VALIDATED
CDC20 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 20
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001255.2-872s21c1
Sequence:CCGGGCAGAAACGGCTTCGAAATATCTCGAGATATTTCGAAGCCGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001255.2-1602s21c1
Sequence:CCGGAGACCAACCCATCACCTCAGTCTCGAGACTGAGGTGATGGGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001255.2-921s21c1
Sequence:CCGGCTAAGCTGGAACAGCTATATCCTCGAGGATATAGCTGTTCCAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001255.2-631s21c1
Sequence:CCGGATGCGCCTGAAATCCGAAATGCTCGAGCATTTCGGATTTCAGGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001255.2-1079s21c1
Sequence:CCGGTGGTGGTAATGATAACTTGGTCTCGAGACCAAGTTATCATTACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1611s1c1
Sequence:CCGGAGACCAACCCATCACCTCAGTCTCGAGACTGAGGTGATGGGTTGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1155s1c1
Sequence:CCGGCAGACATTCACCCAGCATCAACTCGAGTTGATGCTGGGTGAATGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1088s1c1
Sequence:CCGGTGGTGGTAATGATAACTTGGTCTCGAGACCAAGTTATCATTACCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1336s1c1
Sequence:CCGGCCCATTACAAGGAGCTCATCTCTCGAGAGATGAGCTCCTTGTAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1367s1c1
Sequence:CCGGCTTTGCACAGAACCAGCTAGTCTCGAGACTAGCTGGTTCTGTGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001255
VALIDATED
CDC20 MISSION shRNA shRNA Plasmid DNA
cell division cycle 20
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001255.2-872s21c1
Sequence:CCGGGCAGAAACGGCTTCGAAATATCTCGAGATATTTCGAAGCCGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001255.2-1602s21c1
Sequence:CCGGAGACCAACCCATCACCTCAGTCTCGAGACTGAGGTGATGGGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001255.2-921s21c1
Sequence:CCGGCTAAGCTGGAACAGCTATATCCTCGAGGATATAGCTGTTCCAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001255.2-631s21c1
Sequence:CCGGATGCGCCTGAAATCCGAAATGCTCGAGCATTTCGGATTTCAGGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001255.2-1079s21c1
Sequence:CCGGTGGTGGTAATGATAACTTGGTCTCGAGACCAAGTTATCATTACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1611s1c1
Sequence:CCGGAGACCAACCCATCACCTCAGTCTCGAGACTGAGGTGATGGGTTGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1155s1c1
Sequence:CCGGCAGACATTCACCCAGCATCAACTCGAGTTGATGCTGGGTGAATGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1088s1c1
Sequence:CCGGTGGTGGTAATGATAACTTGGTCTCGAGACCAAGTTATCATTACCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1336s1c1
Sequence:CCGGCCCATTACAAGGAGCTCATCTCTCGAGAGATGAGCTCCTTGTAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1367s1c1
Sequence:CCGGCTTTGCACAGAACCAGCTAGTCTCGAGACTAGCTGGTTCTGTGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001255
VALIDATED
CDC20 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 20
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001255.2-872s21c1
Sequence:CCGGGCAGAAACGGCTTCGAAATATCTCGAGATATTTCGAAGCCGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001255.2-1602s21c1
Sequence:CCGGAGACCAACCCATCACCTCAGTCTCGAGACTGAGGTGATGGGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001255.2-921s21c1
Sequence:CCGGCTAAGCTGGAACAGCTATATCCTCGAGGATATAGCTGTTCCAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001255.2-631s21c1
Sequence:CCGGATGCGCCTGAAATCCGAAATGCTCGAGCATTTCGGATTTCAGGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001255.2-1079s21c1
Sequence:CCGGTGGTGGTAATGATAACTTGGTCTCGAGACCAAGTTATCATTACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1611s1c1
Sequence:CCGGAGACCAACCCATCACCTCAGTCTCGAGACTGAGGTGATGGGTTGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1155s1c1
Sequence:CCGGCAGACATTCACCCAGCATCAACTCGAGTTGATGCTGGGTGAATGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1088s1c1
Sequence:CCGGTGGTGGTAATGATAACTTGGTCTCGAGACCAAGTTATCATTACCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1336s1c1
Sequence:CCGGCCCATTACAAGGAGCTCATCTCTCGAGAGATGAGCTCCTTGTAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001255.x-1367s1c1
Sequence:CCGGCTTTGCACAGAACCAGCTAGTCTCGAGACTAGCTGGTTCTGTGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023223
VALIDATED
CDC20 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 20
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023223.2-990s21c1
Sequence:CCGGGCAGCAGAAACGACTTCGAAACTCGAGTTTCGAAGTCGTTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023223.2-1041s21c1
Sequence:CCGGCCTCAGTTGGAACAGCTATATCTCGAGATATAGCTGTTCCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023223.2-392s21c1
Sequence:CCGGGCCGAACTCCTGGCAAATCTACTCGAGTAGATTTGCCAGGAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023223.2-766s21c1
Sequence:CCGGCGGAATGACTACTACCTGAATCTCGAGATTCAGGTAGTAGTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023223.1-670s1c1
Sequence:CCGGCGGAATGACTACTACCTGAATCTCGAGATTCAGGTAGTAGTCATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023223.1-945s1c1
Sequence:CCGGCCTCAGTTGGAACAGCTATATCTCGAGATATAGCTGTTCCAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023223.1-1352s1c1
Sequence:CCGGCCCACTATAAGGAGCTGATCTCTCGAGAGATCAGCTCCTTATAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023223.1-894s1c1
Sequence:CCGGGCAGCAGAAACGACTTCGAAACTCGAGTTTCGAAGTCGTTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023223.1-296s1c1
Sequence:CCGGGCCGAACTCCTGGCAAATCTACTCGAGTAGATTTGCCAGGAGTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023223
VALIDATED
CDC20 MISSION shRNA shRNA Plasmid DNA
cell division cycle 20
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023223.2-990s21c1
Sequence:CCGGGCAGCAGAAACGACTTCGAAACTCGAGTTTCGAAGTCGTTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023223.2-1041s21c1
Sequence:CCGGCCTCAGTTGGAACAGCTATATCTCGAGATATAGCTGTTCCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023223.2-392s21c1
Sequence:CCGGGCCGAACTCCTGGCAAATCTACTCGAGTAGATTTGCCAGGAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023223.2-766s21c1
Sequence:CCGGCGGAATGACTACTACCTGAATCTCGAGATTCAGGTAGTAGTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023223.1-670s1c1
Sequence:CCGGCGGAATGACTACTACCTGAATCTCGAGATTCAGGTAGTAGTCATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023223.1-945s1c1
Sequence:CCGGCCTCAGTTGGAACAGCTATATCTCGAGATATAGCTGTTCCAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023223.1-1352s1c1
Sequence:CCGGCCCACTATAAGGAGCTGATCTCTCGAGAGATCAGCTCCTTATAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023223.1-894s1c1
Sequence:CCGGGCAGCAGAAACGACTTCGAAACTCGAGTTTCGAAGTCGTTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023223.1-296s1c1
Sequence:CCGGGCCGAACTCCTGGCAAATCTACTCGAGTAGATTTGCCAGGAGTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023223
VALIDATED
CDC20 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 20
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023223.2-990s21c1
Sequence:CCGGGCAGCAGAAACGACTTCGAAACTCGAGTTTCGAAGTCGTTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023223.2-1041s21c1
Sequence:CCGGCCTCAGTTGGAACAGCTATATCTCGAGATATAGCTGTTCCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023223.2-392s21c1
Sequence:CCGGGCCGAACTCCTGGCAAATCTACTCGAGTAGATTTGCCAGGAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023223.2-766s21c1
Sequence:CCGGCGGAATGACTACTACCTGAATCTCGAGATTCAGGTAGTAGTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023223.1-670s1c1
Sequence:CCGGCGGAATGACTACTACCTGAATCTCGAGATTCAGGTAGTAGTCATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023223.1-945s1c1
Sequence:CCGGCCTCAGTTGGAACAGCTATATCTCGAGATATAGCTGTTCCAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023223.1-1352s1c1
Sequence:CCGGCCCACTATAAGGAGCTGATCTCTCGAGAGATCAGCTCCTTATAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023223.1-894s1c1
Sequence:CCGGGCAGCAGAAACGACTTCGAAACTCGAGTTTCGAAGTCGTTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023223.1-296s1c1
Sequence:CCGGGCCGAACTCCTGGCAAATCTACTCGAGTAGATTTGCCAGGAGTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks