EMAIL THIS PAGE TO A FRIEND

CDC23

cell division cycle 23

59 Gene Product Result for
Synonyms: ANAPC8 APC8 CUT23
Gene ID:
Human(8697) Summary: The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae Cdc23, a protein essential for cell cycle progression through the G2/M transition. This protein is a component of anaphase-promoting complex (APC), which is composed of eight protein subunits and highly conserved in eukaryotic cells. APC catalyzes the formation of cyclin B-ubiquitin conjugate that is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. This protein and 3 other members of the APC complex contain the TPR (tetratricopeptide repeat), a protein domain important for protein-protein interaction. [provided by RefSeq, Jul 2008]
Mouse(52563) CDC23 cell division cycle 23
Rat(291689) cell division cycle 23
Zebrafish(393907) CDC23 (cell division cycle 23, yeast, homolog)
cow(512651) cell division cycle 23 homolog (S. cerevisiae)
domestic cat(101086445) cell division cycle 23 homolog (S. cerevisiae)
dog(481526) cell division cycle 23 homolog (S. cerevisiae)
chicken(771857) cell division cycle 23 homolog (S. cerevisiae)
fruit fly(35315) CG2508 gene product from transcript CG2508-RA
naked mole-rat(101711746) cell division cycle 23
domestic guinea pig(100733068) cell division cycle 23
sheep(101109612) cell division cycle 23 homolog (S. cerevisiae)
Domestic Rabbit(100345665) cell division cycle 23 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178347 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178347 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178347 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004661 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004661 Rosetta Predictions human pricing
NM_001100659 Rosetta Predictions rat pricing
NM_178347 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080676 predicted 1564
2 SASI_Hs01_00080677 predicted 653
3 SASI_Hs01_00080678 predicted 1666
4 SASI_Hs01_00080680 predicted 1787
5 SASI_Hs02_00338077 predicted 603
6 SASI_Hs01_00080681 predicted 1249
7 SASI_Hs01_00080683 predicted 778
8 SASI_Hs01_00080684 predicted 307
9 SASI_Hs02_00338078 predicted 1066
10 SASI_Hs02_00338079 predicted 974
11 SASI_Hs01_00080675 predicted 975
12 SASI_Hs01_00080679 predicted 529
13 SASI_Hs01_00080682 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210218 predicted 1093
2 SASI_Rn02_00210219 predicted 592
3 SASI_Rn02_00210220 predicted 1834
4 SASI_Rn02_00210221 predicted 827
5 SASI_Rn02_00210222 predicted 2061
6 SASI_Rn02_00210223 predicted 1551
7 SASI_Rn02_00210224 predicted 1043
8 SASI_Rn02_00210225 predicted 1401
9 SASI_Rn02_00210226 predicted 2054
10 SASI_Rn02_00210227 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348739 predicted 865
2 SASI_Mm01_00142709 predicted 362
3 SASI_Mm01_00142710 predicted 819
4 SASI_Mm01_00142711 predicted 957
5 SASI_Mm01_00142712 predicted 1785
6 SASI_Mm01_00142713 predicted 986
7 SASI_Mm01_00142714 predicted 415
8 SASI_Mm01_00142715 predicted 1490
9 SASI_Mm01_00142716 predicted 1840
10 SASI_Mm01_00142717 predicted 601
11 SASI_Mm01_00142718 predicted 446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178347
VALIDATED
CDC23 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 23
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178347.4-843s21c1
Sequence:CCGGGCCTATCACAATATCAGAGATCTCGAGATCTCTGATATTGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178347.4-1570s21c1
Sequence:CCGGGATACCTGGCCCAGTACTATTCTCGAGAATAGTACTGGGCCAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178347.4-1030s21c1
Sequence:CCGGGCTGTGTAATTGGCAATTATTCTCGAGAATAATTGCCAATTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178347.4-1490s21c1
Sequence:CCGGCCAGTGTTACATCAAATACATCTCGAGATGTATTTGATGTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178347.4-2264s21c1
Sequence:CCGGGCCTCCCTAATGATAGCATTACTCGAGTAATGCTATCATTAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178347.2-2265s1c1
Sequence:CCGGGCCTCCCTAATGATAGCATTACTCGAGTAATGCTATCATTAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178347.2-1031s1c1
Sequence:CCGGGCTGTGTAATTGGCAATTATTCTCGAGAATAATTGCCAATTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178347.2-844s1c1
Sequence:CCGGGCCTATCACAATATCAGAGATCTCGAGATCTCTGATATTGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178347.2-845s1c1
Sequence:CCGGCCTATCACAATATCAGAGATACTCGAGTATCTCTGATATTGTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178347.2-1491s1c1
Sequence:CCGGCCAGTGTTACATCAAATACATCTCGAGATGTATTTGATGTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178347
VALIDATED
CDC23 MISSION shRNA shRNA Plasmid DNA
cell division cycle 23
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178347.4-843s21c1
Sequence:CCGGGCCTATCACAATATCAGAGATCTCGAGATCTCTGATATTGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178347.4-1570s21c1
Sequence:CCGGGATACCTGGCCCAGTACTATTCTCGAGAATAGTACTGGGCCAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178347.4-1030s21c1
Sequence:CCGGGCTGTGTAATTGGCAATTATTCTCGAGAATAATTGCCAATTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178347.4-1490s21c1
Sequence:CCGGCCAGTGTTACATCAAATACATCTCGAGATGTATTTGATGTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178347.4-2264s21c1
Sequence:CCGGGCCTCCCTAATGATAGCATTACTCGAGTAATGCTATCATTAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178347.2-2265s1c1
Sequence:CCGGGCCTCCCTAATGATAGCATTACTCGAGTAATGCTATCATTAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178347.2-1031s1c1
Sequence:CCGGGCTGTGTAATTGGCAATTATTCTCGAGAATAATTGCCAATTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178347.2-844s1c1
Sequence:CCGGGCCTATCACAATATCAGAGATCTCGAGATCTCTGATATTGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178347.2-845s1c1
Sequence:CCGGCCTATCACAATATCAGAGATACTCGAGTATCTCTGATATTGTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178347.2-1491s1c1
Sequence:CCGGCCAGTGTTACATCAAATACATCTCGAGATGTATTTGATGTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178347
VALIDATED
CDC23 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 23
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178347.4-843s21c1
Sequence:CCGGGCCTATCACAATATCAGAGATCTCGAGATCTCTGATATTGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178347.4-1570s21c1
Sequence:CCGGGATACCTGGCCCAGTACTATTCTCGAGAATAGTACTGGGCCAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178347.4-1030s21c1
Sequence:CCGGGCTGTGTAATTGGCAATTATTCTCGAGAATAATTGCCAATTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178347.4-1490s21c1
Sequence:CCGGCCAGTGTTACATCAAATACATCTCGAGATGTATTTGATGTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178347.4-2264s21c1
Sequence:CCGGGCCTCCCTAATGATAGCATTACTCGAGTAATGCTATCATTAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178347.2-2265s1c1
Sequence:CCGGGCCTCCCTAATGATAGCATTACTCGAGTAATGCTATCATTAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178347.2-1031s1c1
Sequence:CCGGGCTGTGTAATTGGCAATTATTCTCGAGAATAATTGCCAATTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178347.2-844s1c1
Sequence:CCGGGCCTATCACAATATCAGAGATCTCGAGATCTCTGATATTGTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178347.2-845s1c1
Sequence:CCGGCCTATCACAATATCAGAGATACTCGAGTATCTCTGATATTGTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178347.2-1491s1c1
Sequence:CCGGCCAGTGTTACATCAAATACATCTCGAGATGTATTTGATGTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004661
VALIDATED
CDC23 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 23
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004661.3-2790s21c1
Sequence:CCGGGCAGGAGGTAATATGCTATAACTCGAGTTATAGCATATTACCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004661.3-994s21c1
Sequence:CCGGTAACCTCTGTGAGATTGATAACTCGAGTTATCAATCTCACAGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004661.3-1572s21c1
Sequence:CCGGGCTATCTGGCCCAGTACTATTCTCGAGAATAGTACTGGGCCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004661.3-1490s21c1
Sequence:CCGGGCCCAGTGTTACATCAAATATCTCGAGATATTTGATGTAACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004661.3-816s21c1
Sequence:CCGGGCTCGTATATTGTTTCCCAAACTCGAGTTTGGGAAACAATATACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004661.2-2778s1c1
Sequence:CCGGGCAGGAGGTAATATGCTATAACTCGAGTTATAGCATATTACCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004661.2-803s1c1
Sequence:CCGGGCTCGTATATTGTTTCCCAAACTCGAGTTTGGGAAACAATATACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004661.2-75s1c1
Sequence:CCGGCCTGTCCATAAACAGCGATTTCTCGAGAAATCGCTGTTTATGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004661.2-1173s1c1
Sequence:CCGGCCAGGCTTATAGACATGCCATCTCGAGATGGCATGTCTATAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004661.2-1477s1c1
Sequence:CCGGGCCCAGTGTTACATCAAATATCTCGAGATATTTGATGTAACACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004661
VALIDATED
CDC23 MISSION shRNA shRNA Plasmid DNA
cell division cycle 23
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004661.3-2790s21c1
Sequence:CCGGGCAGGAGGTAATATGCTATAACTCGAGTTATAGCATATTACCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004661.3-994s21c1
Sequence:CCGGTAACCTCTGTGAGATTGATAACTCGAGTTATCAATCTCACAGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004661.3-1572s21c1
Sequence:CCGGGCTATCTGGCCCAGTACTATTCTCGAGAATAGTACTGGGCCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004661.3-1490s21c1
Sequence:CCGGGCCCAGTGTTACATCAAATATCTCGAGATATTTGATGTAACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004661.3-816s21c1
Sequence:CCGGGCTCGTATATTGTTTCCCAAACTCGAGTTTGGGAAACAATATACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004661.2-2778s1c1
Sequence:CCGGGCAGGAGGTAATATGCTATAACTCGAGTTATAGCATATTACCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004661.2-803s1c1
Sequence:CCGGGCTCGTATATTGTTTCCCAAACTCGAGTTTGGGAAACAATATACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004661.2-75s1c1
Sequence:CCGGCCTGTCCATAAACAGCGATTTCTCGAGAAATCGCTGTTTATGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004661.2-1173s1c1
Sequence:CCGGCCAGGCTTATAGACATGCCATCTCGAGATGGCATGTCTATAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004661.2-1477s1c1
Sequence:CCGGGCCCAGTGTTACATCAAATATCTCGAGATATTTGATGTAACACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004661
VALIDATED
CDC23 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 23
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004661.3-2790s21c1
Sequence:CCGGGCAGGAGGTAATATGCTATAACTCGAGTTATAGCATATTACCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004661.3-994s21c1
Sequence:CCGGTAACCTCTGTGAGATTGATAACTCGAGTTATCAATCTCACAGAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004661.3-1572s21c1
Sequence:CCGGGCTATCTGGCCCAGTACTATTCTCGAGAATAGTACTGGGCCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004661.3-1490s21c1
Sequence:CCGGGCCCAGTGTTACATCAAATATCTCGAGATATTTGATGTAACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004661.3-816s21c1
Sequence:CCGGGCTCGTATATTGTTTCCCAAACTCGAGTTTGGGAAACAATATACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004661.2-2778s1c1
Sequence:CCGGGCAGGAGGTAATATGCTATAACTCGAGTTATAGCATATTACCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004661.2-803s1c1
Sequence:CCGGGCTCGTATATTGTTTCCCAAACTCGAGTTTGGGAAACAATATACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004661.2-75s1c1
Sequence:CCGGCCTGTCCATAAACAGCGATTTCTCGAGAAATCGCTGTTTATGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004661.2-1173s1c1
Sequence:CCGGCCAGGCTTATAGACATGCCATCTCGAGATGGCATGTCTATAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004661.2-1477s1c1
Sequence:CCGGGCCCAGTGTTACATCAAATATCTCGAGATATTTGATGTAACACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks