EMAIL THIS PAGE TO A FRIEND

CDC25A

cell division cycle 25A

205 Gene Product Result for
Synonyms: CDC25A2
UniProtKB ID: P30304, Q8IZH5, Q96IL3, Q9H2F2
Gene ID:
Human(993) Summary: CDC25A is a member of the CDC25 family of phosphatases. CDC25A is required for progression from G1 to the S phase of the cell cycle. It activates the cyclin-dependent kinase CDC2 by removing two phosphate groups. CDC25A is specifically degraded in response to DNA damage, which prevents cells with chromosomal abnormalities from progressing through cell division. CDC25A is an oncogene, although its exact role in oncogenesis has not been demonstrated. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12530) cell division cycle 25A
Rat(171102) cell division cycle 25A
chicken(420375) cell division cycle 25 homolog A (S. pombe)
cow(520188) cell division cycle 25 homolog A (S. pombe)
Horse(100064223) cell division cycle 25 homolog A (S. pombe)
domestic cat(101098445) cell division cycle 25 homolog A (S. pombe)
dog(484780) cell division cycle 25 homolog A (S. pombe)
sheep(101113178) cell division cycle 25 homolog A (S. pombe)
domestic guinea pig(100721008) cell division cycle 25A
naked mole-rat(101699133) cell division cycle 25A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300430 Anti-CDC25A (Ab-76) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
GW21526 Anti-CDC25a antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA005855 Anti-CDC25A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2100380 Anti-CDC25A antibody produced in rabbit affinity isolated antibody bovine, rabbit, canine, rat, zebrafish, guinea pig, human, mouse, horse
western blot pricing
SAB4503734 Anti-CDC25A antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4503736 Anti-CDC25A antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4503735 Anti-CDC25A, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4504141 Anti-phospho-CDC25A (pSer124) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301569 Anti-phospho-CDC25A (pSer124) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4504576 Anti-phospho-CDC25A (pSer178) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301446 Anti-phospho-CDC25A (pSer178) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504360 Anti-phospho-CDC25A (pSer75) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300114 Anti-phospho-CDC25A (pSer76) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4301572 Anti-phospho-CDC25A (pThr507) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
WH0000993M1 Monoclonal Anti-CDC25A antibody produced in mouse clone 3D5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0021 Rabbit anti-CDC25a Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N1786 NSC 95397 ≥97% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001789 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007658 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007658 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007658 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001789 Rosetta Predictions human pricing
NM_201567 Rosetta Predictions human pricing
NM_133571 Rosetta Predictions rat pricing
NM_007658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017714 predicted 1762
2 SASI_Hs01_00017715 predicted 1445
3 SASI_Hs01_00017716 predicted 1371
4 SASI_Hs01_00017717 predicted 1386
5 SASI_Hs01_00017718 predicted 1490
6 SASI_Hs01_00017719 predicted 1695
7 SASI_Hs01_00017720 predicted 1354
8 SASI_Hs01_00017721 predicted 1514
9 SASI_Hs01_00017722 predicted 1259
10 SASI_Hs01_00017723 predicted 1619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027056 predicted 1644
2 SASI_Hs01_00027057 predicted 1330
3 SASI_Hs01_00027058 predicted 1257
4 SASI_Hs01_00027059 predicted 1271
5 SASI_Hs01_00027060 predicted 1376
6 SASI_Hs01_00027061 predicted 1577
7 SASI_Hs01_00027062 predicted 1233
8 SASI_Hs01_00027063 predicted 1391
9 SASI_Hs01_00027064 predicted 1138
10 SASI_Hs01_00027065 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090937 predicted 810
2 SASI_Rn01_00090938 predicted 1360
3 SASI_Rn01_00090939 predicted 403
4 SASI_Rn01_00090940 predicted 1324
5 SASI_Rn01_00090942 predicted 1562
6 SASI_Rn02_00267764 predicted 1300
7 SASI_Rn01_00090943 predicted 1315
8 SASI_Rn01_00090945 predicted 1358
9 SASI_Rn01_00090946 predicted 1348
10 SASI_Rn02_00267765 predicted 1802
11 SASI_Rn01_00090941 predicted 1300
12 SASI_Rn01_00090944 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044109 predicted 1376
2 SASI_Mm01_00044110 predicted 1394
3 SASI_Mm01_00044111 predicted 693
4 SASI_Mm01_00044112 predicted 1409
5 SASI_Mm01_00044113 predicted 894
6 SASI_Mm01_00044114 predicted 1487
7 SASI_Mm01_00044115 predicted 1500
8 SASI_Mm01_00044116 predicted 1459
9 SASI_Mm02_00312160 predicted 899
10 SASI_Mm01_00044117 predicted 599
11 SASI_Mm01_00044118 predicted 1694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001789
VALIDATED
CDC25A MISSION shRNA Bacterial Glycerol Stock
cell division cycle 25A
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-1918s1c1
Sequence:CCGGCCCATGCACCACGAGGACTTTCTCGAGAAAGTCCTCGTGGTGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-529s1c1
Sequence:CCGGCCCGTCGTGAAGGCGCTATTTCTCGAGAAATAGCGCCTTCACGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-646s1c1
Sequence:CCGGGAGGTGAAGAACAACAGTAATCTCGAGATTACTGTTGTTCTTCACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-1081s1c1
Sequence:CCGGGCCACTTTGTCTGATGAGGATCTCGAGATCCTCATCAGACAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-2149s1c1
Sequence:CCGGGACTTCCATGCCTTAAACCTACTCGAGTAGGTTTAAGGCATGGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1417s21c1
Sequence:CCGGTGGGAAACATCAGGATTTAAACTCGAGTTTAAATCCTGATGTTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1122s21c1
Sequence:CCGGACAACCGATGCAAGCTGTTTGCTCGAGCAAACAGCTTGCATCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1097s21c1
Sequence:CCGGCTCGTCATGAGAACTACAAACCTCGAGGTTTGTAGTTCTCATGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001789.2-2141s21c1
Sequence:CCGGTAGACGTCCTCCGTCCATATCCTCGAGGATATGGACGGAGGACGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001789.2-2412s21c1
Sequence:CCGGCTAACTCCTGGAGACTTATTTCTCGAGAAATAAGTCTCCAGGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-906s21c1
Sequence:CCGGCTCGGATGCTTTCCTCAAATGCTCGAGCATTTGAGGAAAGCATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1768s21c1
Sequence:CCGGGGGATACAAGGAGTTCTTTATCTCGAGATAAAGAACTCCTTGTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001789.2-2377s21c1
Sequence:CCGGTCAACTTCATCAATCACTTTACTCGAGTAAAGTGATTGATGAAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1359s21c1
Sequence:CCGGATGACCCAAGGGACCTTATAGCTCGAGCTATAAGGTCCCTTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-607s21c1
Sequence:CCGGTTCAGGTTTCTGTCTAGATTCCTCGAGGAATCTAGACAGAAACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-491s21c1
Sequence:CCGGACCAACCTGACCGTCACTATGCTCGAGCATAGTGACGGTCAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001789.2-1708s21c1
Sequence:CCGGAGATCGCCTGGGTAATGAATACTCGAGTATTCATTACCCAGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-522s21c1
Sequence:CCGGAGGGTCTGGGCAGTGATTATGCTCGAGCATAATCACTGCCCAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001789
VALIDATED
CDC25A MISSION shRNA shRNA Plasmid DNA
cell division cycle 25A
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-1918s1c1
Sequence:CCGGCCCATGCACCACGAGGACTTTCTCGAGAAAGTCCTCGTGGTGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-529s1c1
Sequence:CCGGCCCGTCGTGAAGGCGCTATTTCTCGAGAAATAGCGCCTTCACGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-646s1c1
Sequence:CCGGGAGGTGAAGAACAACAGTAATCTCGAGATTACTGTTGTTCTTCACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-1081s1c1
Sequence:CCGGGCCACTTTGTCTGATGAGGATCTCGAGATCCTCATCAGACAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-2149s1c1
Sequence:CCGGGACTTCCATGCCTTAAACCTACTCGAGTAGGTTTAAGGCATGGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1417s21c1
Sequence:CCGGTGGGAAACATCAGGATTTAAACTCGAGTTTAAATCCTGATGTTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1122s21c1
Sequence:CCGGACAACCGATGCAAGCTGTTTGCTCGAGCAAACAGCTTGCATCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1097s21c1
Sequence:CCGGCTCGTCATGAGAACTACAAACCTCGAGGTTTGTAGTTCTCATGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001789.2-2141s21c1
Sequence:CCGGTAGACGTCCTCCGTCCATATCCTCGAGGATATGGACGGAGGACGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001789.2-2412s21c1
Sequence:CCGGCTAACTCCTGGAGACTTATTTCTCGAGAAATAAGTCTCCAGGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-906s21c1
Sequence:CCGGCTCGGATGCTTTCCTCAAATGCTCGAGCATTTGAGGAAAGCATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1768s21c1
Sequence:CCGGGGGATACAAGGAGTTCTTTATCTCGAGATAAAGAACTCCTTGTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001789.2-2377s21c1
Sequence:CCGGTCAACTTCATCAATCACTTTACTCGAGTAAAGTGATTGATGAAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1359s21c1
Sequence:CCGGATGACCCAAGGGACCTTATAGCTCGAGCTATAAGGTCCCTTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-607s21c1
Sequence:CCGGTTCAGGTTTCTGTCTAGATTCCTCGAGGAATCTAGACAGAAACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-491s21c1
Sequence:CCGGACCAACCTGACCGTCACTATGCTCGAGCATAGTGACGGTCAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001789.2-1708s21c1
Sequence:CCGGAGATCGCCTGGGTAATGAATACTCGAGTATTCATTACCCAGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-522s21c1
Sequence:CCGGAGGGTCTGGGCAGTGATTATGCTCGAGCATAATCACTGCCCAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001789
VALIDATED
CDC25A MISSION shRNA Lentiviral Transduction Particles
cell division cycle 25A
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-1918s1c1
Sequence:CCGGCCCATGCACCACGAGGACTTTCTCGAGAAAGTCCTCGTGGTGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-529s1c1
Sequence:CCGGCCCGTCGTGAAGGCGCTATTTCTCGAGAAATAGCGCCTTCACGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-646s1c1
Sequence:CCGGGAGGTGAAGAACAACAGTAATCTCGAGATTACTGTTGTTCTTCACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-1081s1c1
Sequence:CCGGGCCACTTTGTCTGATGAGGATCTCGAGATCCTCATCAGACAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001789.x-2149s1c1
Sequence:CCGGGACTTCCATGCCTTAAACCTACTCGAGTAGGTTTAAGGCATGGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1417s21c1
Sequence:CCGGTGGGAAACATCAGGATTTAAACTCGAGTTTAAATCCTGATGTTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1122s21c1
Sequence:CCGGACAACCGATGCAAGCTGTTTGCTCGAGCAAACAGCTTGCATCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1097s21c1
Sequence:CCGGCTCGTCATGAGAACTACAAACCTCGAGGTTTGTAGTTCTCATGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001789.2-2141s21c1
Sequence:CCGGTAGACGTCCTCCGTCCATATCCTCGAGGATATGGACGGAGGACGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001789.2-2412s21c1
Sequence:CCGGCTAACTCCTGGAGACTTATTTCTCGAGAAATAAGTCTCCAGGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-906s21c1
Sequence:CCGGCTCGGATGCTTTCCTCAAATGCTCGAGCATTTGAGGAAAGCATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1768s21c1
Sequence:CCGGGGGATACAAGGAGTTCTTTATCTCGAGATAAAGAACTCCTTGTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001789.2-2377s21c1
Sequence:CCGGTCAACTTCATCAATCACTTTACTCGAGTAAAGTGATTGATGAAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-1359s21c1
Sequence:CCGGATGACCCAAGGGACCTTATAGCTCGAGCTATAAGGTCCCTTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-607s21c1
Sequence:CCGGTTCAGGTTTCTGTCTAGATTCCTCGAGGAATCTAGACAGAAACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-491s21c1
Sequence:CCGGACCAACCTGACCGTCACTATGCTCGAGCATAGTGACGGTCAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001789.2-1708s21c1
Sequence:CCGGAGATCGCCTGGGTAATGAATACTCGAGTATTCATTACCCAGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001789.2-522s21c1
Sequence:CCGGAGGGTCTGGGCAGTGATTATGCTCGAGCATAATCACTGCCCAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007658
VALIDATED
CDC25A MISSION shRNA Bacterial Glycerol Stock
cell division cycle 25A
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007658.1-1351s1c1
Sequence:CCGGCCTGAGCTGTATGTCCTGAAACTCGAGTTTCAGGACATACAGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007658.1-1090s1c1
Sequence:CCGGGCCAGTCTCATTAAAGAGTTTCTCGAGAAACTCTTTAATGAGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007658.1-1887s1c1
Sequence:CCGGGCTGGCCAAATACCAAAGATACTCGAGTATCTTTGGTATTTGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007658.1-995s1c1
Sequence:CCGGCCAAGGGTTATCTCTTTAATACTCGAGTATTAAAGAGATAACCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007658.1-464s1c1
Sequence:CCGGCGTCACATCTACAGGAGAGTACTCGAGTACTCTCCTGTAGATGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-1565s21c1
Sequence:CCGGACATCAAGGGTGCCGTGAATCCTCGAGGATTCACGGCACCCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-1613s21c1
Sequence:CCGGTCTTACTTAAGAACCCTATTGCTCGAGCAATAGGGTTCTTAAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-1376s21c1
Sequence:CCGGGTGACCCAAGAGACCTTATAGCTCGAGCTATAAGGTCTCTTGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-703s21c1
Sequence:CCGGGAAATTTCCCTGACGAGAATACTCGAGTATTCTCGTCAGGGAAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007658.3-651s21c1
Sequence:CCGGTTCAGGTTTCTGTCTAGATTCCTCGAGGAATCTAGACAGAAACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-934s21c1
Sequence:CCGGGCTCGGATGCTATCTTCAAATCTCGAGATTTGAAGATAGCATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007658
VALIDATED
CDC25A MISSION shRNA shRNA Plasmid DNA
cell division cycle 25A
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007658.1-1351s1c1
Sequence:CCGGCCTGAGCTGTATGTCCTGAAACTCGAGTTTCAGGACATACAGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007658.1-1090s1c1
Sequence:CCGGGCCAGTCTCATTAAAGAGTTTCTCGAGAAACTCTTTAATGAGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007658.1-1887s1c1
Sequence:CCGGGCTGGCCAAATACCAAAGATACTCGAGTATCTTTGGTATTTGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007658.1-995s1c1
Sequence:CCGGCCAAGGGTTATCTCTTTAATACTCGAGTATTAAAGAGATAACCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007658.1-464s1c1
Sequence:CCGGCGTCACATCTACAGGAGAGTACTCGAGTACTCTCCTGTAGATGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-1565s21c1
Sequence:CCGGACATCAAGGGTGCCGTGAATCCTCGAGGATTCACGGCACCCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-1613s21c1
Sequence:CCGGTCTTACTTAAGAACCCTATTGCTCGAGCAATAGGGTTCTTAAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-1376s21c1
Sequence:CCGGGTGACCCAAGAGACCTTATAGCTCGAGCTATAAGGTCTCTTGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-703s21c1
Sequence:CCGGGAAATTTCCCTGACGAGAATACTCGAGTATTCTCGTCAGGGAAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007658.3-651s21c1
Sequence:CCGGTTCAGGTTTCTGTCTAGATTCCTCGAGGAATCTAGACAGAAACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-934s21c1
Sequence:CCGGGCTCGGATGCTATCTTCAAATCTCGAGATTTGAAGATAGCATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007658
VALIDATED
CDC25A MISSION shRNA Lentiviral Transduction Particles
cell division cycle 25A
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007658.1-1351s1c1
Sequence:CCGGCCTGAGCTGTATGTCCTGAAACTCGAGTTTCAGGACATACAGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007658.1-1090s1c1
Sequence:CCGGGCCAGTCTCATTAAAGAGTTTCTCGAGAAACTCTTTAATGAGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007658.1-1887s1c1
Sequence:CCGGGCTGGCCAAATACCAAAGATACTCGAGTATCTTTGGTATTTGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007658.1-995s1c1
Sequence:CCGGCCAAGGGTTATCTCTTTAATACTCGAGTATTAAAGAGATAACCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007658.1-464s1c1
Sequence:CCGGCGTCACATCTACAGGAGAGTACTCGAGTACTCTCCTGTAGATGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-1565s21c1
Sequence:CCGGACATCAAGGGTGCCGTGAATCCTCGAGGATTCACGGCACCCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-1613s21c1
Sequence:CCGGTCTTACTTAAGAACCCTATTGCTCGAGCAATAGGGTTCTTAAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-1376s21c1
Sequence:CCGGGTGACCCAAGAGACCTTATAGCTCGAGCTATAAGGTCTCTTGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-703s21c1
Sequence:CCGGGAAATTTCCCTGACGAGAATACTCGAGTATTCTCGTCAGGGAAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007658.3-651s21c1
Sequence:CCGGTTCAGGTTTCTGTCTAGATTCCTCGAGGAATCTAGACAGAAACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007658.3-934s21c1
Sequence:CCGGGCTCGGATGCTATCTTCAAATCTCGAGATTTGAAGATAGCATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks