EMAIL THIS PAGE TO A FRIEND

CDC25B

cell division cycle 25B

168 Gene Product Result for
Gene ID:
Human(994) Summary: CDC25B is a member of the CDC25 family of phosphatases. CDC25B activates the cyclin dependent kinase CDC2 by removing two phosphate groups and it is required for entry into mitosis. CDC25B shuttles between the nucleus and the cytoplasm due to nuclear localization and nuclear export signals. The protein is nuclear in the M and G1 phases of the cell cycle and moves to the cytoplasm during S and G2. CDC25B has oncogenic properties, although its role in tumor formation has not been determined. Multiple transcript variants for this gene exist. [provided by RefSeq, Jul 2008]
Mouse(12531) cell division cycle 25B
Rat(171103) cell division cycle 25B
naked mole-rat(101701077) cell division cycle 25B
domestic guinea pig(100716851) cell division cycle 25B
sheep(101120511) cell division cycle 25 homolog B (S. pombe)
domestic cat(101092757) cell division cycle 25 homolog B (S. pombe)
cow(505847) cell division cycle 25 homolog B (S. pombe)
Horse(100052425) cell division cycle 25 homolog B (S. pombe)
dog(485790) cell division cycle 25 homolog B (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41336 Anti-CDC25B (AB1) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, rabbit, horse, bovine, mouse, canine, human, pig
immunohistochemistry, western blot pricing
AV03041 Anti-CDC25B (AB2) antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, canine, pig
immunohistochemistry, western blot pricing
GW21527 Anti-CDC25b antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2107993 Anti-CDC25B antibody produced in rabbit affinity isolated antibody pig, guinea pig, horse, bovine, human, rat, canine, mouse, rabbit
immunohistochemistry, western blot pricing
HPA038892 Anti-CDC25B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA038893 Anti-CDC25B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4503739 Anti-CDC25B antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB4503740 Anti-CDC25B antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4300617 Anti-phospho-Cdc25b (pSer149) antibody produced in rabbit affinity isolated antibody mouse
western blot pricing
SAB4503810 Anti-phospho-CDC25B (pSer323) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4504142 Anti-phospho-CDC25B (pSer353) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301447 Anti-phospho-CDC25B (pSer353) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
WH0000994M1 Monoclonal Anti-CDC25B antibody produced in mouse clone 7E8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N7537 NSC 663284 ≥98% (HPLC), solid human pricing
N1786 NSC 95397 ≥97% (HPLC) human pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1060 MCF10A CELLS CDC25B (-/-) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004358 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004358 Rosetta Predictions human pricing
NM_021872 Rosetta Predictions human pricing
NM_021873 Rosetta Predictions human pricing
NM_133572 Rosetta Predictions rat pricing
NM_001111075 Rosetta Predictions mouse pricing
NM_023117 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169483 predicted 2378
2 SASI_Hs01_00169484 predicted 2074
3 SASI_Hs01_00169485 predicted 2691
4 SASI_Hs01_00169486 predicted 1908
5 SASI_Hs01_00169487 predicted 1564
6 SASI_Hs01_00169488 predicted 1550
7 SASI_Hs01_00169489 predicted 2277
8 SASI_Hs01_00169490 predicted 2710
9 SASI_Hs01_00169491 predicted 2717
10 SASI_Hs02_00337424 predicted 2394
11 SASI_Hs01_00169492 predicted 2366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151105 predicted 2291
2 SASI_Hs01_00151106 predicted 1995
3 SASI_Hs01_00151107 predicted 2618
4 SASI_Hs01_00151108 predicted 1825
5 SASI_Hs01_00151109 predicted 1480
6 SASI_Hs01_00151110 predicted 1466
7 SASI_Hs01_00151111 predicted 2192
8 SASI_Hs01_00151112 predicted 2625
9 SASI_Hs01_00151113 predicted 2639
10 SASI_Hs02_00355151 predicted 2308
11 SASI_Hs01_00151114 predicted 2291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211369 predicted 2421
2 SASI_Hs01_00211370 predicted 2119
3 SASI_Hs01_00211371 predicted 2735
4 SASI_Hs01_00211372 predicted 1945
5 SASI_Hs01_00211373 predicted 1603
6 SASI_Hs01_00211374 predicted 1590
7 SASI_Hs01_00211375 predicted 2312
8 SASI_Hs01_00211376 predicted 2751
9 SASI_Hs01_00211377 predicted 2761
10 SASI_Hs02_00355152 predicted 2428
11 SASI_Hs01_00211378 predicted 2404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047513 predicted 1057
2 SASI_Rn01_00047514 predicted 1031
3 SASI_Rn01_00047515 predicted 1566
4 SASI_Rn01_00047517 predicted 1490
5 SASI_Rn01_00047519 predicted 394
6 SASI_Rn01_00047520 predicted 611
7 SASI_Rn01_00047521 predicted 921
8 SASI_Rn01_00047522 predicted 1552
9 SASI_Rn02_00267766 predicted 1055
10 SASI_Rn02_00267767 predicted 543
11 SASI_Rn01_00047516 predicted 1154
12 SASI_Rn01_00047518 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306325 predicted 2157
2 SASI_Mm02_00306326 predicted 1476
3 SASI_Mm02_00306327 predicted 1421
4 SASI_Mm02_00306328 predicted 1626
5 SASI_Mm02_00306329 predicted 382
6 SASI_Mm02_00306330 predicted 1770
7 SASI_Mm02_00306331 predicted 2172
8 SASI_Mm02_00306332 predicted 1466
9 SASI_Mm02_00306333 predicted 1252
10 SASI_Mm02_00306334 predicted 1800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326798 predicted 2238
2 SASI_Mm01_00172921 predicted 1562
3 SASI_Mm01_00172923 predicted 1503
4 SASI_Mm01_00172924 predicted 1708
5 SASI_Mm01_00172927 predicted 388
6 SASI_Mm01_00172928 predicted 1841
7 SASI_Mm02_00326799 predicted 2246
8 SASI_Mm02_00326800 predicted 1546
9 SASI_Mm02_00326801 predicted 1334
10 SASI_Mm02_00326802 predicted 1880
11 SASI_Mm01_00172919 predicted 677
12 SASI_Mm01_00172920 predicted 1335
13 SASI_Mm01_00172922 predicted 1018
14 SASI_Mm01_00172925 predicted 801
15 SASI_Mm01_00172926 predicted 1022
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023117
VALIDATED
CDC25B MISSION shRNA Bacterial Glycerol Stock
cell division cycle 25B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023117.2-1877s21c1
Sequence:CCGGGCTGAGGAACTTTCGCCTTAACTCGAGTTAAGGCGAAAGTTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023117.2-600s21c1
Sequence:CCGGCGCACGTTTGAACAGGCCATTCTCGAGAATGGCCTGTTCAAACGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023117.2-1301s21c1
Sequence:CCGGGCAGCAGCTTGAAGAACCTAACTCGAGTTAGGTTCTTCAAGCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023117.2-1767s21c1
Sequence:CCGGCCGGAGATGTACATCCTCAAACTCGAGTTTGAGGATGTACATCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-1987s1c1
Sequence:CCGGCCTGTCTCACTCCACTTATTTCTCGAGAAATAAGTGGAGTGAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-1639s1c1
Sequence:CCGGCCGGAGATGTACATCCTCAAACTCGAGTTTGAGGATGTACATCTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-1749s1c1
Sequence:CCGGGCTGAGGAACTTTCGCCTTAACTCGAGTTAAGGCGAAAGTTCCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-472s1c1
Sequence:CCGGCGCACGTTTGAACAGGCCATTCTCGAGAATGGCCTGTTCAAACGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-1173s1c1
Sequence:CCGGGCAGCAGCTTGAAGAACCTAACTCGAGTTAGGTTCTTCAAGCTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023117
VALIDATED
CDC25B MISSION shRNA shRNA Plasmid DNA
cell division cycle 25B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023117.2-1877s21c1
Sequence:CCGGGCTGAGGAACTTTCGCCTTAACTCGAGTTAAGGCGAAAGTTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023117.2-600s21c1
Sequence:CCGGCGCACGTTTGAACAGGCCATTCTCGAGAATGGCCTGTTCAAACGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023117.2-1301s21c1
Sequence:CCGGGCAGCAGCTTGAAGAACCTAACTCGAGTTAGGTTCTTCAAGCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023117.2-1767s21c1
Sequence:CCGGCCGGAGATGTACATCCTCAAACTCGAGTTTGAGGATGTACATCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-1987s1c1
Sequence:CCGGCCTGTCTCACTCCACTTATTTCTCGAGAAATAAGTGGAGTGAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-1639s1c1
Sequence:CCGGCCGGAGATGTACATCCTCAAACTCGAGTTTGAGGATGTACATCTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-1749s1c1
Sequence:CCGGGCTGAGGAACTTTCGCCTTAACTCGAGTTAAGGCGAAAGTTCCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-472s1c1
Sequence:CCGGCGCACGTTTGAACAGGCCATTCTCGAGAATGGCCTGTTCAAACGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-1173s1c1
Sequence:CCGGGCAGCAGCTTGAAGAACCTAACTCGAGTTAGGTTCTTCAAGCTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023117
VALIDATED
CDC25B MISSION shRNA Lentiviral Transduction Particles
cell division cycle 25B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023117.2-1877s21c1
Sequence:CCGGGCTGAGGAACTTTCGCCTTAACTCGAGTTAAGGCGAAAGTTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023117.2-600s21c1
Sequence:CCGGCGCACGTTTGAACAGGCCATTCTCGAGAATGGCCTGTTCAAACGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023117.2-1301s21c1
Sequence:CCGGGCAGCAGCTTGAAGAACCTAACTCGAGTTAGGTTCTTCAAGCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023117.2-1767s21c1
Sequence:CCGGCCGGAGATGTACATCCTCAAACTCGAGTTTGAGGATGTACATCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-1987s1c1
Sequence:CCGGCCTGTCTCACTCCACTTATTTCTCGAGAAATAAGTGGAGTGAGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-1639s1c1
Sequence:CCGGCCGGAGATGTACATCCTCAAACTCGAGTTTGAGGATGTACATCTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-1749s1c1
Sequence:CCGGGCTGAGGAACTTTCGCCTTAACTCGAGTTAAGGCGAAAGTTCCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-472s1c1
Sequence:CCGGCGCACGTTTGAACAGGCCATTCTCGAGAATGGCCTGTTCAAACGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023117.1-1173s1c1
Sequence:CCGGGCAGCAGCTTGAAGAACCTAACTCGAGTTAGGTTCTTCAAGCTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004358
VALIDATED
CDC25B MISSION shRNA Bacterial Glycerol Stock
cell division cycle 25B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004358.3-1179s21c1
Sequence:CCGGGCTTCCAGTCTATGCCGGTGACTCGAGTCACCGGCATAGACTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004358.3-1035s21c1
Sequence:CCGGCGTCTGAATCCTCCGAATCTTCTCGAGAAGATTCGGAGGATTCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004358.3-3296s21c1
Sequence:CCGGGCTGTCTTGTTGCGGATGGATCTCGAGATCCATCCGCAACAAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004358.3-1903s21c1
Sequence:CCGGCCGAGAGCTGATTGGAGATTACTCGAGTAATCTCCAATCAGCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004358.3-1969s21c1
Sequence:CCGGCCTCAAGTACATCTCACCAGACTCGAGTCTGGTGAGATGTACTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004358.x-479s1c1
Sequence:CCGGCGTCTGAATCCTCCGAATCTTCTCGAGAAGATTCGGAGGATTCAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004358.x-1347s1c1
Sequence:CCGGCCGAGAGCTGATTGGAGATTACTCGAGTAATCTCCAATCAGCTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004358.x-2738s1c1
Sequence:CCGGGCTGTCTTGTTGCGGATGGATCTCGAGATCCATCCGCAACAAGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004358.x-1413s1c1
Sequence:CCGGCCTCAAGTACATCTCACCAGACTCGAGTCTGGTGAGATGTACTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004358.x-623s1c1
Sequence:CCGGGCTTCCAGTCTATGCCGGTGACTCGAGTCACCGGCATAGACTGGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004358
VALIDATED
CDC25B MISSION shRNA shRNA Plasmid DNA
cell division cycle 25B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004358.3-1179s21c1
Sequence:CCGGGCTTCCAGTCTATGCCGGTGACTCGAGTCACCGGCATAGACTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004358.3-1035s21c1
Sequence:CCGGCGTCTGAATCCTCCGAATCTTCTCGAGAAGATTCGGAGGATTCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004358.3-3296s21c1
Sequence:CCGGGCTGTCTTGTTGCGGATGGATCTCGAGATCCATCCGCAACAAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004358.3-1903s21c1
Sequence:CCGGCCGAGAGCTGATTGGAGATTACTCGAGTAATCTCCAATCAGCTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004358.3-1969s21c1
Sequence:CCGGCCTCAAGTACATCTCACCAGACTCGAGTCTGGTGAGATGTACTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004358.x-479s1c1
Sequence:CCGGCGTCTGAATCCTCCGAATCTTCTCGAGAAGATTCGGAGGATTCAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004358.x-1347s1c1
Sequence:CCGGCCGAGAGCTGATTGGAGATTACTCGAGTAATCTCCAATCAGCTCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004358.x-2738s1c1
Sequence:CCGGGCTGTCTTGTTGCGGATGGATCTCGAGATCCATCCGCAACAAGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004358.x-1413s1c1
Sequence:CCGGCCTCAAGTACATCTCACCAGACTCGAGTCTGGTGAGATGTACTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004358.x-623s1c1
Sequence:CCGGGCTTCCAGTCTATGCCGGTGACTCGAGTCACCGGCATAGACTGGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004358
VALIDATED
CDC25B MISSION shRNA Lentiviral Transduction Particles
cell division cycle 25B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004358.3-1179s21c1
Sequence:CCGGGCTTCCAGTCTATGCCGGTGACTCGAGTCACCGGCATAGACTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004358.3-1035s21c1
Sequence:CCGGCGTCTGAATCCTCCGAATCTTCTCGAGAAGATTCGGAGGATTCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004358.3-3296s21c1
Sequence:CCGGGCTGTCTTGTTGCGGATGGATCTCGAGATCCATCCGCAACAAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004358.3-1903s21c1
Sequence:CCGGCCGAGAGCTGATTGGAGATTACTCGAGTAATCTCCAATCAGCTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004358.3-1969s21c1
Sequence:CCGGCCTCAAGTACATCTCACCAGACTCGAGTCTGGTGAGATGTACTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004358.x-479s1c1
Sequence:CCGGCGTCTGAATCCTCCGAATCTTCTCGAGAAGATTCGGAGGATTCAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004358.x-1347s1c1
Sequence:CCGGCCGAGAGCTGATTGGAGATTACTCGAGTAATCTCCAATCAGCTCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004358.x-2738s1c1
Sequence:CCGGGCTGTCTTGTTGCGGATGGATCTCGAGATCCATCCGCAACAAGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004358.x-1413s1c1
Sequence:CCGGCCTCAAGTACATCTCACCAGACTCGAGTCTGGTGAGATGTACTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004358.x-623s1c1
Sequence:CCGGGCTTCCAGTCTATGCCGGTGACTCGAGTCACCGGCATAGACTGGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)