EMAIL THIS PAGE TO A FRIEND

CDC25C

cell division cycle 25C

116 Gene Product Result for
Synonyms: CDC25 PPP1R60
Gene ID:
Human(995) Summary: This gene is highly conserved during evolution and it plays a key role in the regulation of cell division. The encoded protein is a tyrosine phosphatase and belongs to the Cdc25 phosphatase family. It directs dephosphorylation of cyclin B-bound CDC2 and triggers entry into mitosis. It is also thought to suppress p53-induced growth arrest. Multiple alternatively spliced transcript variants of this gene have been described, however, the full-length nature of many of them is not known. [provided by RefSeq, Jul 2008]
Mouse(12532) cell division cycle 25C
Rat(307511) cell division cycle 25C
dog(610456) cell division cycle 25 homolog C (S. pombe)
cow(507731) cell division cycle 25 homolog C (S. pombe)
Horse(100062352) cell division cycle 25 homolog C (S. pombe)
domestic cat(101086942) cell division cycle 25 homolog C (S. pombe)
sheep(101110327) cell division cycle 25 homolog C (S. pombe)
Domestic Rabbit(100343637) cell division cycle 25 homolog C (S. pombe)
naked mole-rat(101712931) cell division cycle 25C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300416 Anti-CDC25C (Ab-216) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
GW21532 Anti-CDC25c antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2100381 Anti-CDC25C antibody produced in rabbit affinity isolated antibody rabbit, mouse, human, rat
western blot pricing
SAB4503746 Anti-CDC25C antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
HPA066991 Anti-CDC25C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4503745 Anti-CDC25C, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4301348 Anti-phospho-CDC25C (pSer198) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4300097 Anti-phospho-CDC25C (pSer216) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing
SAB4504361 Anti-phospho-CDC25C (pSer216) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504024 Anti-phospho-CDC25C (pThr48) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
C0349 Monoclonal Anti-Cdc25c antibody produced in mouse clone DCS-193, ascites fluid human
microarray, western blot pricing
WH0000995M1 Monoclonal Anti-CDC25C antibody produced in mouse clone 3B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403653 Monoclonal Anti-CDC25C antibody produced in mouse clone 3B11, ascites fluid human
ELISA, western blot pricing
PLA0186 Rabbit anti-CDC25c Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, chimpanzee, primate, gorilla
immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N1786 NSC 95397 ≥97% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001790 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU175451 MISSION® esiRNA esiRNA targeting mouse Cdc25c mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001790 Rosetta Predictions human pricing
NM_022809 Rosetta Predictions human pricing
NM_001107396 Rosetta Predictions rat pricing
NM_009860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192785 predicted 1599
2 SASI_Hs01_00192787 predicted 1278
3 SASI_Hs01_00192789 predicted 1312
4 SASI_Hs01_00192790 predicted 1461
5 SASI_Hs01_00192791 predicted 1769
6 SASI_Hs01_00192792 predicted 1288
7 SASI_Hs01_00192793 predicted 1435
8 SASI_Hs01_00192786 predicted 1704
9 SASI_Hs02_00332552 predicted 1356
10 SASI_Hs01_00192794 predicted 1217
11 SASI_Hs01_00192788 predicted 1777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088949 predicted 1383
2 SASI_Hs01_00088951 predicted 1061
3 SASI_Hs01_00088953 predicted 1100
4 SASI_Hs01_00088954 predicted 1240
5 SASI_Hs01_00088955 predicted 1548
6 SASI_Hs01_00088956 predicted 1068
7 SASI_Hs01_00088957 predicted 1222
8 SASI_Hs01_00088950 predicted 1485
9 SASI_Hs02_00356108 predicted 1134
10 SASI_Hs01_00088958 predicted 996
11 SASI_Hs01_00088952 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228405 predicted 1342
2 SASI_Rn02_00228406 predicted 1438
3 SASI_Rn02_00228407 predicted 1473
4 SASI_Rn02_00228408 predicted 1617
5 SASI_Rn02_00228409 predicted 1273
6 SASI_Rn02_00228410 predicted 1447
7 SASI_Rn02_00228411 predicted 1309
8 SASI_Rn02_00228412 predicted 1462
9 SASI_Rn02_00228413 predicted 1078
10 SASI_Rn02_00228414 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108862 predicted 817
2 SASI_Mm02_00317277 predicted 1295
3 SASI_Mm01_00108863 predicted 1157
4 SASI_Mm01_00108864 predicted 1656
5 SASI_Mm02_00317278 predicted 667
6 SASI_Mm02_00317279 predicted 940
7 SASI_Mm02_00317280 predicted 1314
8 SASI_Mm02_00317281 predicted 1425
9 SASI_Mm02_00317282 predicted 1109
10 SASI_Mm02_00317283 predicted 766
11 SASI_Mm01_00108865 predicted 1162
12 SASI_Mm01_00108866 predicted 865
13 SASI_Mm01_00108867 predicted 891
14 SASI_Mm01_00108868 predicted 970
15 SASI_Mm01_00108869 predicted 545
16 SASI_Mm01_00108870 predicted 986
17 SASI_Mm01_00108871 predicted 1112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009860
VALIDATED
CDC25C MISSION shRNA Bacterial Glycerol Stock
cell division cycle 25C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009860.1-910s1c1
Sequence:CCGGGCGTAGCACATCTGCACATAACTCGAGTTATGTGCAGATGTGCTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009860.1-1661s1c1
Sequence:CCGGGCATTATATTACCCTGAGCTACTCGAGTAGCTCAGGGTAATATAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009860.1-823s1c1
Sequence:CCGGCCAGGACCTTATGAAAGGTATCTCGAGATACCTTTCATAAGGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009860.1-1122s1c1
Sequence:CCGGCGGTTCCTAAGCTGAGTCAAACTCGAGTTTGACTCAGCTTAGGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009860.1-616s1c1
Sequence:CCGGCCCTGAATCTCCGAAAGACAACTCGAGTTGTCTTTCGGAGATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009860.2-1109s21c1
Sequence:GTACCGGAGAGCTTCTGATTGGTGATTTCTCGAGAAATCACCAATCAGAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009860.2-1746s21c1
Sequence:CCGGGTCATCTTCCATGTCGCTAATCTCGAGATTAGCGACATGGAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009860.2-1466s21c1
Sequence:CCGGGAACCAGTATCCGGCATTATACTCGAGTATAATGCCGGATACTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009860.2-1166s21c1
Sequence:CCGGACACCCGGATCTGAAGTATATCTCGAGATATACTTCAGATCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009860.2-782s21c1
Sequence:CCGGGCGTAGCACATCTGCACATAACTCGAGTTATGTGCAGATGTGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009860
VALIDATED
CDC25C MISSION shRNA shRNA Plasmid DNA
cell division cycle 25C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009860.1-910s1c1
Sequence:CCGGGCGTAGCACATCTGCACATAACTCGAGTTATGTGCAGATGTGCTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009860.1-1661s1c1
Sequence:CCGGGCATTATATTACCCTGAGCTACTCGAGTAGCTCAGGGTAATATAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009860.1-823s1c1
Sequence:CCGGCCAGGACCTTATGAAAGGTATCTCGAGATACCTTTCATAAGGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009860.1-1122s1c1
Sequence:CCGGCGGTTCCTAAGCTGAGTCAAACTCGAGTTTGACTCAGCTTAGGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009860.1-616s1c1
Sequence:CCGGCCCTGAATCTCCGAAAGACAACTCGAGTTGTCTTTCGGAGATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009860.2-1109s21c1
Sequence:GTACCGGAGAGCTTCTGATTGGTGATTTCTCGAGAAATCACCAATCAGAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009860.2-1746s21c1
Sequence:CCGGGTCATCTTCCATGTCGCTAATCTCGAGATTAGCGACATGGAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009860.2-1466s21c1
Sequence:CCGGGAACCAGTATCCGGCATTATACTCGAGTATAATGCCGGATACTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009860.2-1166s21c1
Sequence:CCGGACACCCGGATCTGAAGTATATCTCGAGATATACTTCAGATCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009860.2-782s21c1
Sequence:CCGGGCGTAGCACATCTGCACATAACTCGAGTTATGTGCAGATGTGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009860
VALIDATED
CDC25C MISSION shRNA Lentiviral Transduction Particles
cell division cycle 25C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009860.1-910s1c1
Sequence:CCGGGCGTAGCACATCTGCACATAACTCGAGTTATGTGCAGATGTGCTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009860.1-1661s1c1
Sequence:CCGGGCATTATATTACCCTGAGCTACTCGAGTAGCTCAGGGTAATATAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009860.1-823s1c1
Sequence:CCGGCCAGGACCTTATGAAAGGTATCTCGAGATACCTTTCATAAGGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009860.1-1122s1c1
Sequence:CCGGCGGTTCCTAAGCTGAGTCAAACTCGAGTTTGACTCAGCTTAGGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009860.1-616s1c1
Sequence:CCGGCCCTGAATCTCCGAAAGACAACTCGAGTTGTCTTTCGGAGATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009860.2-1109s21c1
Sequence:GTACCGGAGAGCTTCTGATTGGTGATTTCTCGAGAAATCACCAATCAGAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009860.2-1746s21c1
Sequence:CCGGGTCATCTTCCATGTCGCTAATCTCGAGATTAGCGACATGGAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009860.2-1466s21c1
Sequence:CCGGGAACCAGTATCCGGCATTATACTCGAGTATAATGCCGGATACTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009860.2-1166s21c1
Sequence:CCGGACACCCGGATCTGAAGTATATCTCGAGATATACTTCAGATCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009860.2-782s21c1
Sequence:CCGGGCGTAGCACATCTGCACATAACTCGAGTTATGTGCAGATGTGCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001790
VALIDATED
CDC25C MISSION shRNA Bacterial Glycerol Stock
cell division cycle 25C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001790.x-773s1c1
Sequence:CCGGGTCCCATTACTACTGTTCCAACTCGAGTTGGAACAGTAGTAATGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001790.x-970s1c1
Sequence:CCGGGACAACACAATACCAGATAAACTCGAGTTTATCTGGTATTGTGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001790.x-1907s1c1
Sequence:CCGGGCCTTGAGTTGCATAGAGATTCTCGAGAATCTCTATGCAACTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001790.x-1374s1c1
Sequence:CCGGGAAGAGAATAATCATCGTGTTCTCGAGAACACGATGATTATTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-1253s21c1
Sequence:GTACCGGATTGATTGTCGCTATCCATATCTCGAGATATGGATAGCGACAATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-970s21c1
Sequence:CCGGGGACAACACAATACCAGATAACTCGAGTTATCTGGTATTGTGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-1483s21c1
Sequence:CCGGGTACTACCCAGAGCTATATATCTCGAGATATATAGCTCTGGGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-411s21c1
Sequence:CCGGGAACTCCAGTGGGCAAATTTCCTCGAGGAAATTTGCCCACTGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-1375s21c1
Sequence:CCGGGAAGAGAATAATCATCGTGTTCTCGAGAACACGATGATTATTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001790.3-1907s21c1
Sequence:CCGGGCCTTGAGTTGCATAGAGATTCTCGAGAATCTCTATGCAACTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001790
VALIDATED
CDC25C MISSION shRNA shRNA Plasmid DNA
cell division cycle 25C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001790.x-773s1c1
Sequence:CCGGGTCCCATTACTACTGTTCCAACTCGAGTTGGAACAGTAGTAATGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001790.x-970s1c1
Sequence:CCGGGACAACACAATACCAGATAAACTCGAGTTTATCTGGTATTGTGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001790.x-1907s1c1
Sequence:CCGGGCCTTGAGTTGCATAGAGATTCTCGAGAATCTCTATGCAACTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001790.x-1374s1c1
Sequence:CCGGGAAGAGAATAATCATCGTGTTCTCGAGAACACGATGATTATTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-1253s21c1
Sequence:GTACCGGATTGATTGTCGCTATCCATATCTCGAGATATGGATAGCGACAATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-970s21c1
Sequence:CCGGGGACAACACAATACCAGATAACTCGAGTTATCTGGTATTGTGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-1483s21c1
Sequence:CCGGGTACTACCCAGAGCTATATATCTCGAGATATATAGCTCTGGGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-411s21c1
Sequence:CCGGGAACTCCAGTGGGCAAATTTCCTCGAGGAAATTTGCCCACTGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-1375s21c1
Sequence:CCGGGAAGAGAATAATCATCGTGTTCTCGAGAACACGATGATTATTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001790.3-1907s21c1
Sequence:CCGGGCCTTGAGTTGCATAGAGATTCTCGAGAATCTCTATGCAACTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001790
VALIDATED
CDC25C MISSION shRNA Lentiviral Transduction Particles
cell division cycle 25C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001790.x-773s1c1
Sequence:CCGGGTCCCATTACTACTGTTCCAACTCGAGTTGGAACAGTAGTAATGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001790.x-970s1c1
Sequence:CCGGGACAACACAATACCAGATAAACTCGAGTTTATCTGGTATTGTGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001790.x-1907s1c1
Sequence:CCGGGCCTTGAGTTGCATAGAGATTCTCGAGAATCTCTATGCAACTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001790.x-1374s1c1
Sequence:CCGGGAAGAGAATAATCATCGTGTTCTCGAGAACACGATGATTATTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-1253s21c1
Sequence:GTACCGGATTGATTGTCGCTATCCATATCTCGAGATATGGATAGCGACAATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-970s21c1
Sequence:CCGGGGACAACACAATACCAGATAACTCGAGTTATCTGGTATTGTGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-1483s21c1
Sequence:CCGGGTACTACCCAGAGCTATATATCTCGAGATATATAGCTCTGGGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-411s21c1
Sequence:CCGGGAACTCCAGTGGGCAAATTTCCTCGAGGAAATTTGCCCACTGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001790.3-1375s21c1
Sequence:CCGGGAAGAGAATAATCATCGTGTTCTCGAGAACACGATGATTATTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001790.3-1907s21c1
Sequence:CCGGGCCTTGAGTTGCATAGAGATTCTCGAGAATCTCTATGCAACTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks