EMAIL THIS PAGE TO A FRIEND

CDC26

cell division cycle 26

66 Gene Product Result for
Synonyms: ANAPC12 APC12 C9orf17
UniProtKB ID: Q8NHZ8
Gene ID:
Human(246184) Summary: The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Cdc26, a component of cell cycle anaphase-promoting complex (APC). APC is composed of a group of highly conserved proteins and functions as a cell cycle-regulated ubiquitin-protein ligase. APC thus is responsible for the cell cycle regulated proteolysis of various proteins. [provided by RefSeq, Jul 2008]
Mouse(66440) cell division cycle 26
Rat(366381) cell division cycle 26
Zebrafish(445501) cell division cycle 26 homolog
cow(777693) cell division cycle 26 homolog (S. cerevisiae)
domestic cat(101095692) cell division cycle 26 homolog (S. cerevisiae)
dog(481679) cell division cycle 26 homolog (S. cerevisiae)
chicken(417269) cell division cycle 26 homolog (S. cerevisiae)
naked mole-rat(101705159) cell division cycle 26
domestic guinea pig(100732729) cell division cycle 26
sheep(101108105) cell division cycle 26 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139291 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139291 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139291 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139286 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139286 Rosetta Predictions human pricing
NM_001013240 Rosetta Predictions rat pricing
NM_139291 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364275 predicted 577
2 SASI_Hs01_00230899 predicted 514
3 SASI_Hs01_00230900 predicted 570
4 SASI_Hs01_00230901 predicted 448
5 SASI_Hs01_00230903 predicted 383
6 SASI_Hs01_00230904 predicted 488
7 SASI_Hs01_00230905 predicted 373
8 SASI_Hs01_00230906 predicted 537
9 SASI_Hs01_00230908 predicted 574
10 SASI_Hs02_00364276 predicted 380
11 SASI_Hs01_00230902 predicted 470
12 SASI_Hs01_00230907 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059424 predicted 349
2 SASI_Rn01_00059425 predicted 416
3 SASI_Rn02_00201062 predicted 424
4 SASI_Rn01_00059427 predicted 265
5 SASI_Rn02_00201063 predicted 476
6 SASI_Rn01_00059428 predicted 468
7 SASI_Rn02_00201064 predicted 277
8 SASI_Rn01_00059430 predicted 297
9 SASI_Rn01_00059432 predicted 276
10 SASI_Rn02_00201065 predicted 415
11 SASI_Rn01_00059426 predicted 487
12 SASI_Rn01_00059429 predicted 299
13 SASI_Rn01_00059431 predicted 363
14 SASI_Rn01_00059433 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135110 predicted 369
2 SASI_Mm01_00135111 predicted 502
3 SASI_Mm01_00135112 predicted 294
4 SASI_Mm01_00135113 predicted 444
5 SASI_Mm01_00135114 predicted 368
6 SASI_Mm01_00135115 predicted 494
7 SASI_Mm01_00135116 predicted 325
8 SASI_Mm01_00135117 predicted 380
9 SASI_Mm01_00135118 predicted 294
10 SASI_Mm01_00135119 predicted 280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139291
VALIDATED
CDC26 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 26
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-446s21c1
Sequence:CCGGAGCCGGGAACAAATGATTAATCTCGAGATTAATCATTTGTTCCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-309s21c1
Sequence:CCGGAGCTCAAGCTCGACGACATTGCTCGAGCAATGTCGTCGAGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-589s21c1
Sequence:CCGGAGGAGTACCAACCAGATTTAGCTCGAGCTAAATCTGGTTGGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-382s21c1
Sequence:CCGGAGATGTGGAAGGTGTAGGAACCTCGAGGTTCCTACACCTTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-510s21c1
Sequence:CCGGCATCTCAGTTTGGAAACTTTGCTCGAGCAAAGTTTCCAAACTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139291.1-432s1c1
Sequence:CCGGCCGCACATCTCAGTTTGGAAACTCGAGTTTCCAAACTGAGATGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139291.1-376s1c1
Sequence:CCGGCGGGAACAAATGATTAATGATCTCGAGATCATTAATCATTTGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139291.1-292s1c1
Sequence:CCGGCGTAAGAAGCAGAAGGAAGATCTCGAGATCTTCCTTCTGCTTCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139291
VALIDATED
CDC26 MISSION shRNA shRNA Plasmid DNA
cell division cycle 26
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-446s21c1
Sequence:CCGGAGCCGGGAACAAATGATTAATCTCGAGATTAATCATTTGTTCCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-309s21c1
Sequence:CCGGAGCTCAAGCTCGACGACATTGCTCGAGCAATGTCGTCGAGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-589s21c1
Sequence:CCGGAGGAGTACCAACCAGATTTAGCTCGAGCTAAATCTGGTTGGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-382s21c1
Sequence:CCGGAGATGTGGAAGGTGTAGGAACCTCGAGGTTCCTACACCTTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-510s21c1
Sequence:CCGGCATCTCAGTTTGGAAACTTTGCTCGAGCAAAGTTTCCAAACTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139291.1-432s1c1
Sequence:CCGGCCGCACATCTCAGTTTGGAAACTCGAGTTTCCAAACTGAGATGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139291.1-376s1c1
Sequence:CCGGCGGGAACAAATGATTAATGATCTCGAGATCATTAATCATTTGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139291.1-292s1c1
Sequence:CCGGCGTAAGAAGCAGAAGGAAGATCTCGAGATCTTCCTTCTGCTTCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139291
VALIDATED
CDC26 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 26
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-446s21c1
Sequence:CCGGAGCCGGGAACAAATGATTAATCTCGAGATTAATCATTTGTTCCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-309s21c1
Sequence:CCGGAGCTCAAGCTCGACGACATTGCTCGAGCAATGTCGTCGAGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-589s21c1
Sequence:CCGGAGGAGTACCAACCAGATTTAGCTCGAGCTAAATCTGGTTGGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-382s21c1
Sequence:CCGGAGATGTGGAAGGTGTAGGAACCTCGAGGTTCCTACACCTTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_139291.3-510s21c1
Sequence:CCGGCATCTCAGTTTGGAAACTTTGCTCGAGCAAAGTTTCCAAACTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139291.1-432s1c1
Sequence:CCGGCCGCACATCTCAGTTTGGAAACTCGAGTTTCCAAACTGAGATGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139291.1-376s1c1
Sequence:CCGGCGGGAACAAATGATTAATGATCTCGAGATCATTAATCATTTGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139291.1-292s1c1
Sequence:CCGGCGTAAGAAGCAGAAGGAAGATCTCGAGATCTTCCTTCTGCTTCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139286
CDC26 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 26
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-438s1c1
Sequence:CCGGGAGACCCGTAAGAAACAGAAGCTCGAGCTTCTGTTTCTTACGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139286.3-727s1c1
Sequence:CCGGGCAGAGACAAATCTTCTGCATCTCGAGATGCAGAAGATTTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-419s1c1
Sequence:CCGGGAACATTCGAAAGGACCTGGACTCGAGTCCAGGTCCTTTCGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139286.3-575s1c1
Sequence:CCGGGCCCAATAATCGTTCATCTCACTCGAGTGAGATGAACGATTATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-528s1c1
Sequence:CCGGCGGGAACAAATGATCAATGATCTCGAGATCATTGATCATTTGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-387s1c1
Sequence:CCGGGAGCTAAAGCTTGATGACATTCTCGAGAATGTCATCAAGCTTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139286.3-666s1c1
Sequence:CCGGGCAGAAGTACAAACCAGATTTCTCGAGAAATCTGGTTTGTACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139286.3-395s1c1
Sequence:CCGGGCTTGATGACATTGAAGAGTTCTCGAGAACTCTTCAATGTCATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139286.3-732s1c1
Sequence:CCGGGACAAATCTTCTGCATGAGATCTCGAGATCTCATGCAGAAGATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139286.3-539s1c1
Sequence:CCGGGATCAATGATCGGATTGGTTACTCGAGTAACCAATCCGATCATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-585s1c1
Sequence:CCGGCGTTCATCTCAATTTGGAAGTCTCGAGACTTCCAAATTGAGATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-527s1c1
Sequence:CCGGCCGGGAACAAATGATCAATGACTCGAGTCATTGATCATTTGTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139286
CDC26 MISSION shRNA shRNA Plasmid DNA
cell division cycle 26
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-438s1c1
Sequence:CCGGGAGACCCGTAAGAAACAGAAGCTCGAGCTTCTGTTTCTTACGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139286.3-727s1c1
Sequence:CCGGGCAGAGACAAATCTTCTGCATCTCGAGATGCAGAAGATTTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-419s1c1
Sequence:CCGGGAACATTCGAAAGGACCTGGACTCGAGTCCAGGTCCTTTCGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139286.3-575s1c1
Sequence:CCGGGCCCAATAATCGTTCATCTCACTCGAGTGAGATGAACGATTATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-528s1c1
Sequence:CCGGCGGGAACAAATGATCAATGATCTCGAGATCATTGATCATTTGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-387s1c1
Sequence:CCGGGAGCTAAAGCTTGATGACATTCTCGAGAATGTCATCAAGCTTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139286.3-666s1c1
Sequence:CCGGGCAGAAGTACAAACCAGATTTCTCGAGAAATCTGGTTTGTACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139286.3-395s1c1
Sequence:CCGGGCTTGATGACATTGAAGAGTTCTCGAGAACTCTTCAATGTCATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139286.3-732s1c1
Sequence:CCGGGACAAATCTTCTGCATGAGATCTCGAGATCTCATGCAGAAGATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139286.3-539s1c1
Sequence:CCGGGATCAATGATCGGATTGGTTACTCGAGTAACCAATCCGATCATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-585s1c1
Sequence:CCGGCGTTCATCTCAATTTGGAAGTCTCGAGACTTCCAAATTGAGATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-527s1c1
Sequence:CCGGCCGGGAACAAATGATCAATGACTCGAGTCATTGATCATTTGTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139286
CDC26 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 26
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-438s1c1
Sequence:CCGGGAGACCCGTAAGAAACAGAAGCTCGAGCTTCTGTTTCTTACGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139286.3-727s1c1
Sequence:CCGGGCAGAGACAAATCTTCTGCATCTCGAGATGCAGAAGATTTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-419s1c1
Sequence:CCGGGAACATTCGAAAGGACCTGGACTCGAGTCCAGGTCCTTTCGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139286.3-575s1c1
Sequence:CCGGGCCCAATAATCGTTCATCTCACTCGAGTGAGATGAACGATTATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-528s1c1
Sequence:CCGGCGGGAACAAATGATCAATGATCTCGAGATCATTGATCATTTGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-387s1c1
Sequence:CCGGGAGCTAAAGCTTGATGACATTCTCGAGAATGTCATCAAGCTTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139286.3-666s1c1
Sequence:CCGGGCAGAAGTACAAACCAGATTTCTCGAGAAATCTGGTTTGTACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139286.3-395s1c1
Sequence:CCGGGCTTGATGACATTGAAGAGTTCTCGAGAACTCTTCAATGTCATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139286.3-732s1c1
Sequence:CCGGGACAAATCTTCTGCATGAGATCTCGAGATCTCATGCAGAAGATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139286.3-539s1c1
Sequence:CCGGGATCAATGATCGGATTGGTTACTCGAGTAACCAATCCGATCATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-585s1c1
Sequence:CCGGCGTTCATCTCAATTTGGAAGTCTCGAGACTTCCAAATTGAGATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139286.3-527s1c1
Sequence:CCGGCCGGGAACAAATGATCAATGACTCGAGTCATTGATCATTTGTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks