EMAIL THIS PAGE TO A FRIEND

CDC27

cell division cycle 27

221 Gene Product Result for
Synonyms: ANAPC3 APC3 CDC27Hs D0S1430E D17S978E HNUC NUC2
UniProtKB ID: P30260, G3V1C4, Q16349, Q96F35
Gene ID:
Human(996) Summary: The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae protein Cdc27, and the gene product of Schizosaccharomyces pombe nuc 2. This protein is a component of anaphase-promoting complex (APC), which is composed of eight protein subunits and highly conserved in eucaryotic cells. APC catalyzes the formation of cyclin B-ubiquitin conjugate that is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. This protein and 3 other members of the APC complex contain the TPR (tetratricopeptide repeat), a protein domain important for protein-protein interaction. This protein was shown to interact with mitotic checkpoint proteins including Mad2, p55CDC and BUBR1, and thus may be involved in controlling the timing of mitosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(217232) cell division cycle 27
Rat(360643) cell division cycle 27
Zebrafish(30450) cell division cycle 27
cow(540660) cell division cycle 27 homolog (S. cerevisiae)
Horse(100054552) cell division cycle 27 homolog (S. cerevisiae)
chicken(419960) cell division cycle 27 homolog (S. cerevisiae)
domestic cat(101091234) cell division cycle 27 homolog (S. cerevisiae)
dog(490924) cell division cycle 27 homolog (S. cerevisiae)
fruit fly(38798) CG8610 gene product from transcript CG8610-RB
sheep(101121276) cell division cycle 27 homolog (S. cerevisiae)
domestic guinea pig(100731091) cell division cycle 27
naked mole-rat(101717421) cell division cycle 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114091 Rosetta Predictions human pricing
NM_001256 Rosetta Predictions human pricing
NM_001024793 Rosetta Predictions rat pricing
NM_145436 Rosetta Predictions mouse pricing
XM_001004163 Rosetta Predictions mouse pricing
XM_895207 Rosetta Predictions mouse pricing
XM_903089 Rosetta Predictions mouse pricing
XM_903091 Rosetta Predictions mouse pricing
XM_903092 Rosetta Predictions mouse pricing
XM_903093 Rosetta Predictions mouse pricing
XM_903094 Rosetta Predictions mouse pricing
XM_903095 Rosetta Predictions mouse pricing
XM_903096 Rosetta Predictions mouse pricing
XM_903097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326174 predicted 2127
2 SASI_Hs02_00326175 predicted 2339
3 SASI_Hs02_00326176 predicted 2465
4 SASI_Hs02_00326177 predicted 1945
5 SASI_Hs02_00326178 predicted 2479
6 SASI_Hs02_00326179 predicted 2358
7 SASI_Hs02_00326180 predicted 2049
8 SASI_Hs02_00326181 predicted 2470
9 SASI_Hs02_00326182 predicted 1950
10 SASI_Hs02_00326183 predicted 1941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167079 predicted 2104
2 SASI_Hs01_00167080 predicted 2318
3 SASI_Hs01_00167082 predicted 2441
4 SASI_Hs01_00167083 predicted 1930
5 SASI_Hs02_00331436 predicted 2466
6 SASI_Hs02_00331437 predicted 2342
7 SASI_Hs02_00331438 predicted 2036
8 SASI_Hs01_00167087 predicted 2453
9 SASI_Hs02_00331439 predicted 1931
10 SASI_Hs02_00331440 predicted 1920
11 SASI_Hs01_00167078 predicted 786
12 SASI_Hs01_00167081 predicted 2240
13 SASI_Hs01_00167084 predicted 2338
14 SASI_Hs01_00167085 predicted 1633
15 SASI_Hs01_00167086 predicted 2013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095761 predicted 1873
2 SASI_Rn01_00095762 predicted 730
3 SASI_Rn01_00095763 predicted 2613
4 SASI_Rn02_00202701 predicted 972
5 SASI_Rn01_00095764 predicted 2173
6 SASI_Rn02_00202702 predicted 763
7 SASI_Rn01_00095766 predicted 1857
8 SASI_Rn01_00095767 predicted 2353
9 SASI_Rn01_00095768 predicted 2278
10 SASI_Rn01_00095769 predicted 345
11 SASI_Rn01_00095765 predicted 1822
12 SASI_Rn01_00095770 predicted 2628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340806 predicted 2137
2 SASI_Mm02_00340807 predicted 2176
3 SASI_Mm02_00340808 predicted 880
4 SASI_Mm02_00340809 predicted 1127
5 SASI_Mm02_00340810 predicted 2022
6 SASI_Mm02_00340811 predicted 2124
7 SASI_Mm02_00340812 predicted 2335
8 SASI_Mm02_00340813 predicted 2444
9 SASI_Mm02_00340814 predicted 497
10 SASI_Mm02_00340815 predicted 1871
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281979 predicted 763
2 SASI_Mm01_00281980 predicted 353
3 SASI_Mm01_00281981 predicted 787
4 SASI_Mm01_00281982 predicted 798
5 SASI_Mm01_00281983 predicted 841
6 SASI_Mm01_00281984 predicted 323
7 SASI_Mm01_00281985 predicted 416
8 SASI_Mm01_00281986 predicted 530
9 SASI_Mm01_00281987 predicted 382
10 SASI_Mm01_00281988 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253800 predicted 857
2 SASI_Mm01_00253801 predicted 444
3 SASI_Mm01_00253802 predicted 873
4 SASI_Mm01_00253803 predicted 895
5 SASI_Mm01_00253804 predicted 930
6 SASI_Mm01_00253805 predicted 407
7 SASI_Mm01_00253806 predicted 509
8 SASI_Mm01_00253807 predicted 611
9 SASI_Mm01_00253808 predicted 468
10 SASI_Mm01_00253809 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283458 predicted 444
2 SASI_Mm01_00283459 predicted 412
3 SASI_Mm01_00283460 predicted 468
4 SASI_Mm01_00283461 predicted 444
5 SASI_Mm01_00283462 predicted 386
6 SASI_Mm01_00283463 predicted 271
7 SASI_Mm01_00283464 predicted 507
8 SASI_Mm01_00283465 predicted 988
9 SASI_Mm01_00283466 predicted 315
10 SASI_Mm01_00283467 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213045 predicted 886
2 SASI_Mm01_00213046 predicted 1138
3 SASI_Mm01_00213047 predicted 520
4 SASI_Mm01_00213048 predicted 507
5 SASI_Mm01_00213049 predicted 607
6 SASI_Mm01_00213050 predicted 464
7 SASI_Mm01_00213051 predicted 1484
8 SASI_Mm01_00213052 predicted 775
9 SASI_Mm01_00213053 predicted 1323
10 SASI_Mm01_00213054 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210287 predicted 784
2 SASI_Mm01_00210288 predicted 767
3 SASI_Mm01_00210289 predicted 456
4 SASI_Mm01_00210290 predicted 563
5 SASI_Mm01_00210291 predicted 634
6 SASI_Mm01_00210292 predicted 427
7 SASI_Mm01_00210293 predicted 583
8 SASI_Mm01_00210294 predicted 566
9 SASI_Mm01_00210295 predicted 585
10 SASI_Mm01_00210296 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247288 predicted 761
2 SASI_Mm01_00247289 predicted 746
3 SASI_Mm01_00247290 predicted 1398
4 SASI_Mm01_00247291 predicted 1437
5 SASI_Mm01_00247292 predicted 824
6 SASI_Mm01_00247293 predicted 1276
7 SASI_Mm01_00247294 predicted 1390
8 SASI_Mm01_00247295 predicted 1601
9 SASI_Mm01_00247296 predicted 1708
10 SASI_Mm01_00247297 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217422 predicted 1047
2 SASI_Mm01_00217423 predicted 1021
3 SASI_Mm01_00217424 predicted 1671
4 SASI_Mm01_00217425 predicted 1721
5 SASI_Mm01_00217426 predicted 1114
6 SASI_Mm01_00217427 predicted 1566
7 SASI_Mm01_00217428 predicted 1671
8 SASI_Mm01_00217429 predicted 1881
9 SASI_Mm01_00217430 predicted 1981
10 SASI_Mm01_00217431 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255875 predicted 1268
2 SASI_Mm01_00255876 predicted 1922
3 SASI_Mm01_00255877 predicted 1971
4 SASI_Mm01_00255878 predicted 678
5 SASI_Mm01_00255879 predicted 1362
6 SASI_Mm01_00255880 predicted 1818
7 SASI_Mm01_00255881 predicted 1915
8 SASI_Mm01_00255882 predicted 2127
9 SASI_Mm01_00255883 predicted 2236
10 SASI_Mm01_00255884 predicted 1664
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233599 predicted 1405
2 SASI_Mm01_00233600 predicted 1384
3 SASI_Mm01_00233601 predicted 2045
4 SASI_Mm01_00233602 predicted 2086
5 SASI_Mm01_00233603 predicted 1472
6 SASI_Mm01_00233604 predicted 1926
7 SASI_Mm01_00233605 predicted 2038
8 SASI_Mm01_00233606 predicted 2246
9 SASI_Mm01_00233607 predicted 2355
10 SASI_Mm01_00233608 predicted 1779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269346 predicted 894
2 SASI_Mm01_00269347 predicted 1135
3 SASI_Mm01_00269348 predicted 520
4 SASI_Mm01_00269349 predicted 503
5 SASI_Mm01_00269350 predicted 1138
6 SASI_Mm01_00269351 predicted 610
7 SASI_Mm01_00269352 predicted 469
8 SASI_Mm01_00269353 predicted 778
9 SASI_Mm01_00269354 predicted 911
10 SASI_Mm01_00269355 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001256
VALIDATED
CDC27 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 27
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001256.2-612s1c1
Sequence:CCGGCCAGATCCTGACCAAACATTTCTCGAGAAATGTTTGGTCAGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001256.2-2953s1c1
Sequence:CCGGCCAGAGTTTCTTGGTTGCTTTCTCGAGAAAGCAACCAAGAAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001256.2-3089s1c1
Sequence:CCGGGCCTATAACAGTGACTTGATTCTCGAGAATCAAGTCACTGTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001256.2-2001s1c1
Sequence:CCGGCGAAATGCTATCAGAGTCAATCTCGAGATTGACTCTGATAGCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001256.3-1513s21c1
Sequence:CCGGGATGAGCCTTCTTCGTGAAATCTCGAGATTTCACGAAGAAGGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001256.3-2953s21c1
Sequence:CCGGCCAGAGTTTCTTGGTTGCTTTCTCGAGAAAGCAACCAAGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001256.3-1927s21c1
Sequence:CCGGCGCTTATGCCTATACTCTATTCTCGAGAATAGAGTATAGGCATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001256.3-611s21c1
Sequence:CCGGCCAGATCCTGACCAAACATTTCTCGAGAAATGTTTGGTCAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001256.3-686s21c1
Sequence:CCGGCAAGTACCTAATCATAGTTTACTCGAGTAAACTATGATTAGGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001256
VALIDATED
CDC27 MISSION shRNA shRNA Plasmid DNA
cell division cycle 27
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001256.2-612s1c1
Sequence:CCGGCCAGATCCTGACCAAACATTTCTCGAGAAATGTTTGGTCAGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001256.2-2953s1c1
Sequence:CCGGCCAGAGTTTCTTGGTTGCTTTCTCGAGAAAGCAACCAAGAAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001256.2-3089s1c1
Sequence:CCGGGCCTATAACAGTGACTTGATTCTCGAGAATCAAGTCACTGTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001256.2-2001s1c1
Sequence:CCGGCGAAATGCTATCAGAGTCAATCTCGAGATTGACTCTGATAGCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001256.3-1513s21c1
Sequence:CCGGGATGAGCCTTCTTCGTGAAATCTCGAGATTTCACGAAGAAGGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001256.3-2953s21c1
Sequence:CCGGCCAGAGTTTCTTGGTTGCTTTCTCGAGAAAGCAACCAAGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001256.3-1927s21c1
Sequence:CCGGCGCTTATGCCTATACTCTATTCTCGAGAATAGAGTATAGGCATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001256.3-611s21c1
Sequence:CCGGCCAGATCCTGACCAAACATTTCTCGAGAAATGTTTGGTCAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001256.3-686s21c1
Sequence:CCGGCAAGTACCTAATCATAGTTTACTCGAGTAAACTATGATTAGGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001256
VALIDATED
CDC27 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 27
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001256.2-612s1c1
Sequence:CCGGCCAGATCCTGACCAAACATTTCTCGAGAAATGTTTGGTCAGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001256.2-2953s1c1
Sequence:CCGGCCAGAGTTTCTTGGTTGCTTTCTCGAGAAAGCAACCAAGAAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001256.2-3089s1c1
Sequence:CCGGGCCTATAACAGTGACTTGATTCTCGAGAATCAAGTCACTGTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001256.2-2001s1c1
Sequence:CCGGCGAAATGCTATCAGAGTCAATCTCGAGATTGACTCTGATAGCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001256.3-1513s21c1
Sequence:CCGGGATGAGCCTTCTTCGTGAAATCTCGAGATTTCACGAAGAAGGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001256.3-2953s21c1
Sequence:CCGGCCAGAGTTTCTTGGTTGCTTTCTCGAGAAAGCAACCAAGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001256.3-1927s21c1
Sequence:CCGGCGCTTATGCCTATACTCTATTCTCGAGAATAGAGTATAGGCATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001256.3-611s21c1
Sequence:CCGGCCAGATCCTGACCAAACATTTCTCGAGAAATGTTTGGTCAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001256.3-686s21c1
Sequence:CCGGCAAGTACCTAATCATAGTTTACTCGAGTAAACTATGATTAGGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145436
VALIDATED
CDC27 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145436.2-1978s21c1
Sequence:CCGGGAGCATGATATAGCAATTAAACTCGAGTTTAATTGCTATATCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145436.2-2034s21c1
Sequence:CCGGCGCTTACGCCTATACTCTATTCTCGAGAATAGAGTATAGGCGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145436.2-5055s21c1
Sequence:CCGGCTTCGTGGAAATGGTTATTATCTCGAGATAATAACCATTTCCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145436.2-974s21c1
Sequence:CCGGGACCTGGTACTGCCATATTATCTCGAGATAATATGGCAGTACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145436.2-1743s21c1
Sequence:CCGGCCAGATTGGACGGGCTTATTTCTCGAGAAATAAGCCCGTCCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145436
VALIDATED
CDC27 MISSION shRNA shRNA Plasmid DNA
cell division cycle 27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145436.2-1978s21c1
Sequence:CCGGGAGCATGATATAGCAATTAAACTCGAGTTTAATTGCTATATCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145436.2-2034s21c1
Sequence:CCGGCGCTTACGCCTATACTCTATTCTCGAGAATAGAGTATAGGCGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145436.2-5055s21c1
Sequence:CCGGCTTCGTGGAAATGGTTATTATCTCGAGATAATAACCATTTCCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145436.2-974s21c1
Sequence:CCGGGACCTGGTACTGCCATATTATCTCGAGATAATATGGCAGTACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145436.2-1743s21c1
Sequence:CCGGCCAGATTGGACGGGCTTATTTCTCGAGAAATAAGCCCGTCCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145436
VALIDATED
CDC27 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145436.2-1978s21c1
Sequence:CCGGGAGCATGATATAGCAATTAAACTCGAGTTTAATTGCTATATCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145436.2-2034s21c1
Sequence:CCGGCGCTTACGCCTATACTCTATTCTCGAGAATAGAGTATAGGCGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145436.2-5055s21c1
Sequence:CCGGCTTCGTGGAAATGGTTATTATCTCGAGATAATAACCATTTCCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145436.2-974s21c1
Sequence:CCGGGACCTGGTACTGCCATATTATCTCGAGATAATATGGCAGTACCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145436.2-1743s21c1
Sequence:CCGGCCAGATTGGACGGGCTTATTTCTCGAGAAATAAGCCCGTCCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks