EMAIL THIS PAGE TO A FRIEND

CDC34

cell division cycle 34

71 Gene Product Result for
Synonyms: E2-CDC34 UBC3 UBCH3 UBE2R1
UniProtKB ID: P49427, A8K689
Gene ID:
Human(997) Summary: The protein encoded by this gene is a member of the ubiquitin-conjugating enzyme family. Ubiquitin-conjugating enzyme catalyzes the covalent attachment of ubiquitin to other proteins. This protein is a part of the large multiprotein complex, which is required for ubiquitin-mediated degradation of cell cycle G1 regulators, and for the initiation of DNA replication. [provided by RefSeq, Jul 2008]
Mouse(216150) cell division cycle 34
Rat(299602) cell division cycle 34
chicken(425483) cell division cycle 34 homolog (S. cerevisiae)
dog(476759) cell division cycle 34 homolog (S. cerevisiae)
domestic cat(101090492) cell division cycle 34 homolog (S. cerevisiae)
cow(616156) cell division cycle 34 homolog (S. cerevisiae)
naked mole-rat(101722410) cell division cycle 34
domestic guinea pig(100723029) cell division cycle 34
sheep(101107962) cell division cycle 34 homolog (S. cerevisiae)
Domestic Rabbit(100009436) cell division cycle 34 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004359 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004359 Rosetta Predictions human pricing
NM_001013103 Rosetta Predictions rat pricing
NM_177613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337425 predicted 953
2 SASI_Hs01_00071093 predicted 560
3 SASI_Hs01_00071094 predicted 659
4 SASI_Hs01_00071095 predicted 342
5 SASI_Hs01_00071096 predicted 384
6 SASI_Hs01_00071097 predicted 1004
7 SASI_Hs02_00337426 predicted 898
8 SASI_Hs01_00071098 predicted 542
9 SASI_Hs01_00071099 predicted 972
10 SASI_Hs01_00071100 predicted 1166
11 SASI_Hs01_00071101 predicted 973
12 SASI_Hs01_00071102 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200769 predicted 730
2 SASI_Rn02_00200770 predicted 789
3 SASI_Rn02_00200771 predicted 377
4 SASI_Rn02_00200772 predicted 571
5 SASI_Rn02_00200773 predicted 335
6 SASI_Rn02_00200774 predicted 251
7 SASI_Rn02_00200775 predicted 832
8 SASI_Rn02_00200776 predicted 632
9 SASI_Rn02_00200777 predicted 787
10 SASI_Rn02_00200778 predicted 805
11 SASI_Rn01_00087416 predicted 170
12 SASI_Rn01_00087417 predicted 137
13 SASI_Rn01_00087418 predicted 90
14 SASI_Rn01_00087419 predicted 251
15 SASI_Rn01_00087420 predicted 165
16 SASI_Rn01_00087421 predicted 176
17 SASI_Rn01_00087422 predicted 230
18 SASI_Rn01_00087423 predicted 183
19 SASI_Rn01_00087424 predicted 138
20 SASI_Rn01_00087425 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026624 predicted 766
2 SASI_Mm01_00026625 predicted 623
3 SASI_Mm01_00026627 predicted 989
4 SASI_Mm01_00026628 predicted 685
5 SASI_Mm01_00026629 predicted 823
6 SASI_Mm01_00026630 predicted 687
7 SASI_Mm01_00026631 predicted 987
8 SASI_Mm01_00026632 predicted 1005
9 SASI_Mm02_00347842 predicted 625
10 SASI_Mm02_00347843 predicted 748
11 SASI_Mm01_00026626 predicted 780
12 SASI_Mm01_00026633 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177613
VALIDATED
CDC34 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 34
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177613.2-1112s21c1
Sequence:CCGGCCACTCAGCTTTCAGATGATGCTCGAGCATCATCTGAAAGCTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-925s21c1
Sequence:CCGGTGACCCACGTCCCTGAAATAACTCGAGTTATTTCAGGGACGTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-647s21c1
Sequence:CCGGACGCCTCGGTGATGTACAGAACTCGAGTTCTGTACATCACCGAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-890s21c1
Sequence:CCGGGGGATGAAGAGGATGACTCTGCTCGAGCAGAGTCATCCTCTTCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-784s21c1
Sequence:CCGGGAGTACTGCGTGAAGACCAAGCTCGAGCTTGGTCTTCACGCAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-755s21c1
Sequence:CCGGATGGTGTGAAGGTGCCCACTACTCGAGTAGTGGGCACCTTCACACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-489s21c1
Sequence:CCGGGGACGTGTGCATCTCCATTCTCTCGAGAGAATGGAGATGCACACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177613.2-1028s1c1
Sequence:CCGGCCATGATCCTTAGGTCCTCTTCTCGAGAAGAGGACCTAAGGATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177613.2-594s1c1
Sequence:CCGGGAGTGTAATTTCGCTGCTGAACTCGAGTTCAGCAGCGAAATTACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177613.2-693s1c1
Sequence:CCGGCCGCGAGTACACGGACATCATCTCGAGATGATGTCCGTGTACTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177613.2-566s1c1
Sequence:CCGGCCACACAGAATGTCAGAACCACTCGAGTGGTTCTGACATTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177613.2-832s1c1
Sequence:CCGGCTCTTCTACGACGACTACTATCTCGAGATAGTAGTCGTCGTAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177613
VALIDATED
CDC34 MISSION shRNA shRNA Plasmid DNA
cell division cycle 34
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177613.2-1112s21c1
Sequence:CCGGCCACTCAGCTTTCAGATGATGCTCGAGCATCATCTGAAAGCTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-925s21c1
Sequence:CCGGTGACCCACGTCCCTGAAATAACTCGAGTTATTTCAGGGACGTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-647s21c1
Sequence:CCGGACGCCTCGGTGATGTACAGAACTCGAGTTCTGTACATCACCGAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-890s21c1
Sequence:CCGGGGGATGAAGAGGATGACTCTGCTCGAGCAGAGTCATCCTCTTCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-784s21c1
Sequence:CCGGGAGTACTGCGTGAAGACCAAGCTCGAGCTTGGTCTTCACGCAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-755s21c1
Sequence:CCGGATGGTGTGAAGGTGCCCACTACTCGAGTAGTGGGCACCTTCACACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-489s21c1
Sequence:CCGGGGACGTGTGCATCTCCATTCTCTCGAGAGAATGGAGATGCACACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177613.2-1028s1c1
Sequence:CCGGCCATGATCCTTAGGTCCTCTTCTCGAGAAGAGGACCTAAGGATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177613.2-594s1c1
Sequence:CCGGGAGTGTAATTTCGCTGCTGAACTCGAGTTCAGCAGCGAAATTACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177613.2-693s1c1
Sequence:CCGGCCGCGAGTACACGGACATCATCTCGAGATGATGTCCGTGTACTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177613.2-566s1c1
Sequence:CCGGCCACACAGAATGTCAGAACCACTCGAGTGGTTCTGACATTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177613.2-832s1c1
Sequence:CCGGCTCTTCTACGACGACTACTATCTCGAGATAGTAGTCGTCGTAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177613
VALIDATED
CDC34 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 34
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177613.2-1112s21c1
Sequence:CCGGCCACTCAGCTTTCAGATGATGCTCGAGCATCATCTGAAAGCTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-925s21c1
Sequence:CCGGTGACCCACGTCCCTGAAATAACTCGAGTTATTTCAGGGACGTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-647s21c1
Sequence:CCGGACGCCTCGGTGATGTACAGAACTCGAGTTCTGTACATCACCGAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-890s21c1
Sequence:CCGGGGGATGAAGAGGATGACTCTGCTCGAGCAGAGTCATCCTCTTCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-784s21c1
Sequence:CCGGGAGTACTGCGTGAAGACCAAGCTCGAGCTTGGTCTTCACGCAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-755s21c1
Sequence:CCGGATGGTGTGAAGGTGCCCACTACTCGAGTAGTGGGCACCTTCACACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177613.2-489s21c1
Sequence:CCGGGGACGTGTGCATCTCCATTCTCTCGAGAGAATGGAGATGCACACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177613.2-1028s1c1
Sequence:CCGGCCATGATCCTTAGGTCCTCTTCTCGAGAAGAGGACCTAAGGATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177613.2-594s1c1
Sequence:CCGGGAGTGTAATTTCGCTGCTGAACTCGAGTTCAGCAGCGAAATTACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177613.2-693s1c1
Sequence:CCGGCCGCGAGTACACGGACATCATCTCGAGATGATGTCCGTGTACTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177613.2-566s1c1
Sequence:CCGGCCACACAGAATGTCAGAACCACTCGAGTGGTTCTGACATTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177613.2-832s1c1
Sequence:CCGGCTCTTCTACGACGACTACTATCTCGAGATAGTAGTCGTCGTAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004359
VALIDATED
CDC34 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 34
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-295s21c1
Sequence:CCGGGGTGGACGAGGGCGATCTATACTCGAGTATAGATCGCCCTCGTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-574s21c1
Sequence:CCGGGAGTGTGATCTCCCTCCTGAACTCGAGTTCAGGAGGGAGATCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-974s21c1
Sequence:CCGGCAGACTACCTCACGGAGGTTTCTCGAGAAACCTCCGTGAGGTAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-673s21c1
Sequence:CCGGTCGGGAGTACACAGACATCATCTCGAGATGATGTCTGTGTACTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-421s21c1
Sequence:CCGGCTTTCGGTTCCTGACCAAGATCTCGAGATCTTGGTCAGGAACCGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004359.1-916s1c1
Sequence:CCGGCCAGAATAAACTTGCCGAGTTCTCGAGAACTCGGCAAGTTTATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004359.1-421s1c1
Sequence:CCGGCTTTCGGTTCCTGACCAAGATCTCGAGATCTTGGTCAGGAACCGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004359.1-548s1c1
Sequence:CCGGACGCAGAACGTCAGGACCATTCTCGAGAATGGTCCTGACGTTCTGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004359.1-574s1c1
Sequence:CCGGGAGTGTGATCTCCCTCCTGAACTCGAGTTCAGGAGGGAGATCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004359.1-673s1c1
Sequence:CCGGTCGGGAGTACACAGACATCATCTCGAGATGATGTCTGTGTACTCCCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004359
VALIDATED
CDC34 MISSION shRNA shRNA Plasmid DNA
cell division cycle 34
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-295s21c1
Sequence:CCGGGGTGGACGAGGGCGATCTATACTCGAGTATAGATCGCCCTCGTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-574s21c1
Sequence:CCGGGAGTGTGATCTCCCTCCTGAACTCGAGTTCAGGAGGGAGATCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-974s21c1
Sequence:CCGGCAGACTACCTCACGGAGGTTTCTCGAGAAACCTCCGTGAGGTAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-673s21c1
Sequence:CCGGTCGGGAGTACACAGACATCATCTCGAGATGATGTCTGTGTACTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-421s21c1
Sequence:CCGGCTTTCGGTTCCTGACCAAGATCTCGAGATCTTGGTCAGGAACCGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004359.1-916s1c1
Sequence:CCGGCCAGAATAAACTTGCCGAGTTCTCGAGAACTCGGCAAGTTTATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004359.1-421s1c1
Sequence:CCGGCTTTCGGTTCCTGACCAAGATCTCGAGATCTTGGTCAGGAACCGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004359.1-548s1c1
Sequence:CCGGACGCAGAACGTCAGGACCATTCTCGAGAATGGTCCTGACGTTCTGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004359.1-574s1c1
Sequence:CCGGGAGTGTGATCTCCCTCCTGAACTCGAGTTCAGGAGGGAGATCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004359.1-673s1c1
Sequence:CCGGTCGGGAGTACACAGACATCATCTCGAGATGATGTCTGTGTACTCCCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004359
VALIDATED
CDC34 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 34
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-295s21c1
Sequence:CCGGGGTGGACGAGGGCGATCTATACTCGAGTATAGATCGCCCTCGTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-574s21c1
Sequence:CCGGGAGTGTGATCTCCCTCCTGAACTCGAGTTCAGGAGGGAGATCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-974s21c1
Sequence:CCGGCAGACTACCTCACGGAGGTTTCTCGAGAAACCTCCGTGAGGTAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-673s21c1
Sequence:CCGGTCGGGAGTACACAGACATCATCTCGAGATGATGTCTGTGTACTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004359.1-421s21c1
Sequence:CCGGCTTTCGGTTCCTGACCAAGATCTCGAGATCTTGGTCAGGAACCGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004359.1-916s1c1
Sequence:CCGGCCAGAATAAACTTGCCGAGTTCTCGAGAACTCGGCAAGTTTATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004359.1-421s1c1
Sequence:CCGGCTTTCGGTTCCTGACCAAGATCTCGAGATCTTGGTCAGGAACCGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004359.1-548s1c1
Sequence:CCGGACGCAGAACGTCAGGACCATTCTCGAGAATGGTCCTGACGTTCTGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004359.1-574s1c1
Sequence:CCGGGAGTGTGATCTCCCTCCTGAACTCGAGTTCAGGAGGGAGATCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004359.1-673s1c1
Sequence:CCGGTCGGGAGTACACAGACATCATCTCGAGATGATGTCTGTGTACTCCCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks