EMAIL THIS PAGE TO A FRIEND

CDC37

cell division cycle 37

89 Gene Product Result for
Synonyms: P50CDC37
UniProtKB ID: Q16543, Q53YA2
Gene ID:
Human(11140) Summary: The protein encoded by this gene is highly similar to Cdc 37, a cell division cycle control protein of Sacchromyces cerevisiae. This protein is a molecular chaperone with specific function in cell signal transduction. It has been shown to form complex with Hsp90 and a variety of protein kinases including CDK4, CDK6, SRC, RAF-1, MOK, as well as eIF2 alpha kinases. It is thought to play a critical role in directing Hsp90 to its target kinases. [provided by RefSeq, Jul 2008]
Mouse(12539) cell division cycle 37
Rat(114562) cell division cycle 37
Zebrafish(394013) cell division cycle 37 homolog (S. cerevisiae)
cow(520883) cell division cycle 37 homolog (S. cerevisiae)
domestic cat(101090419) cell division cycle 37 homolog (S. cerevisiae)
dog(484955) cell division cycle 37 homolog (S. cerevisiae)
chicken(395430) cell division cycle 37 homolog (S. cerevisiae)
fruit fly(38232) CG12019 gene product from transcript CG12019-RA
naked mole-rat(101716587) cell division cycle 37
domestic guinea pig(100716016) cell division cycle 37
sheep(101113585) cell division cycle 37 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007065 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007065 Rosetta Predictions human pricing
NM_053743 Rosetta Predictions rat pricing
NM_016742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029019 predicted 1228
2 SASI_Hs01_00029020 predicted 1215
3 SASI_Hs01_00029021 predicted 912
4 SASI_Hs01_00029022 predicted 1195
5 SASI_Hs02_00342879 predicted 700
6 SASI_Hs01_00029023 predicted 584
7 SASI_Hs01_00029025 predicted 807
8 SASI_Hs02_00342880 predicted 417
9 SASI_Hs02_00342881 predicted 202
10 SASI_Hs02_00342882 predicted 744
11 SASI_Hs01_00029018 predicted 1422
12 SASI_Hs01_00029024 predicted 583
13 SASI_Hs01_00029026 predicted 1338
14 SASI_Hs01_00029027 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095418 predicted 643
2 SASI_Rn01_00095419 predicted 1006
3 SASI_Rn01_00095420 predicted 1063
4 SASI_Rn01_00095421 predicted 549
5 SASI_Rn01_00095422 predicted 748
6 SASI_Rn01_00095423 predicted 592
7 SASI_Rn01_00095425 predicted 555
8 SASI_Rn02_00266527 predicted 267
9 SASI_Rn01_00095426 predicted 661
10 SASI_Rn01_00095427 predicted 1024
11 SASI_Rn01_00095424 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323465 predicted 559
2 SASI_Mm01_00051369 predicted 964
3 SASI_Mm01_00051370 predicted 971
4 SASI_Mm01_00051371 predicted 808
5 SASI_Mm01_00051372 predicted 408
6 SASI_Mm01_00051373 predicted 799
7 SASI_Mm01_00051374 predicted 517
8 SASI_Mm01_00051375 predicted 485
9 SASI_Mm01_00051376 predicted 868
10 SASI_Mm01_00051377 predicted 514
11 SASI_Mm01_00051378 predicted 1318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016742
VALIDATED
CDC37 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 37
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016742.2-1957s1c1
Sequence:CCGGGCTGGCCTCAAACTCAGATATCTCGAGATATCTGAGTTTGAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016742.2-1026s1c1
Sequence:CCGGGATCCCACTGATGCCAAGTATCTCGAGATACTTGGCATCAGTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016742.2-867s1c1
Sequence:CCGGGAGAAGGCCATGAAGGAATATCTCGAGATATTCCTTCATGGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016742.2-489s1c1
Sequence:CCGGCAGAAACACAAGACCTTCGTTCTCGAGAACGAAGGTCTTGTGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016742.2-554s1c1
Sequence:CCGGCTGGGATGACAGCCAGAAATACTCGAGTATTTCTGGCTGTCATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016742.4-1025s21c1
Sequence:CCGGGATCCCACTGATGCCAAGTATCTCGAGATACTTGGCATCAGTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016742.4-488s21c1
Sequence:CCGGCAGAAACACAAGACCTTCGTTCTCGAGAACGAAGGTCTTGTGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016742.4-553s21c1
Sequence:CCGGCTGGGATGACAGCCAGAAATACTCGAGTATTTCTGGCTGTCATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016742.4-866s21c1
Sequence:CCGGGAGAAGGCCATGAAGGAATATCTCGAGATATTCCTTCATGGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016742
VALIDATED
CDC37 MISSION shRNA shRNA Plasmid DNA
cell division cycle 37
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016742.2-1957s1c1
Sequence:CCGGGCTGGCCTCAAACTCAGATATCTCGAGATATCTGAGTTTGAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016742.2-1026s1c1
Sequence:CCGGGATCCCACTGATGCCAAGTATCTCGAGATACTTGGCATCAGTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016742.2-867s1c1
Sequence:CCGGGAGAAGGCCATGAAGGAATATCTCGAGATATTCCTTCATGGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016742.2-489s1c1
Sequence:CCGGCAGAAACACAAGACCTTCGTTCTCGAGAACGAAGGTCTTGTGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016742.2-554s1c1
Sequence:CCGGCTGGGATGACAGCCAGAAATACTCGAGTATTTCTGGCTGTCATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016742.4-1025s21c1
Sequence:CCGGGATCCCACTGATGCCAAGTATCTCGAGATACTTGGCATCAGTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016742.4-488s21c1
Sequence:CCGGCAGAAACACAAGACCTTCGTTCTCGAGAACGAAGGTCTTGTGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016742.4-553s21c1
Sequence:CCGGCTGGGATGACAGCCAGAAATACTCGAGTATTTCTGGCTGTCATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016742.4-866s21c1
Sequence:CCGGGAGAAGGCCATGAAGGAATATCTCGAGATATTCCTTCATGGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016742
VALIDATED
CDC37 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 37
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016742.2-1957s1c1
Sequence:CCGGGCTGGCCTCAAACTCAGATATCTCGAGATATCTGAGTTTGAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016742.2-1026s1c1
Sequence:CCGGGATCCCACTGATGCCAAGTATCTCGAGATACTTGGCATCAGTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016742.2-867s1c1
Sequence:CCGGGAGAAGGCCATGAAGGAATATCTCGAGATATTCCTTCATGGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016742.2-489s1c1
Sequence:CCGGCAGAAACACAAGACCTTCGTTCTCGAGAACGAAGGTCTTGTGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016742.2-554s1c1
Sequence:CCGGCTGGGATGACAGCCAGAAATACTCGAGTATTTCTGGCTGTCATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016742.4-1025s21c1
Sequence:CCGGGATCCCACTGATGCCAAGTATCTCGAGATACTTGGCATCAGTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016742.4-488s21c1
Sequence:CCGGCAGAAACACAAGACCTTCGTTCTCGAGAACGAAGGTCTTGTGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016742.4-553s21c1
Sequence:CCGGCTGGGATGACAGCCAGAAATACTCGAGTATTTCTGGCTGTCATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016742.4-866s21c1
Sequence:CCGGGAGAAGGCCATGAAGGAATATCTCGAGATATTCCTTCATGGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007065
CDC37 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 37
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007065.3-1424s1c1
Sequence:CCGGGCCCATTCAAGTCTCTGCTTTCTCGAGAAAGCAGAGACTTGAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007065.3-818s1c1
Sequence:CCGGCCGGCAGTTCTTCACTAAGATCTCGAGATCTTAGTGAAGAACTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007065.3-749s1c1
Sequence:CCGGCCAGACAATCGTCATGCAATTCTCGAGAATTGCATGACGATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007065.3-819s1c1
Sequence:CCGGCGGCAGTTCTTCACTAAGATTCTCGAGAATCTTAGTGAAGAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007065.3-671s1c1
Sequence:CCGGGACAGCCAATTACCTGGTCATCTCGAGATGACCAGGTAATTGGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007065
CDC37 MISSION shRNA shRNA Plasmid DNA
cell division cycle 37
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007065.3-1424s1c1
Sequence:CCGGGCCCATTCAAGTCTCTGCTTTCTCGAGAAAGCAGAGACTTGAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007065.3-818s1c1
Sequence:CCGGCCGGCAGTTCTTCACTAAGATCTCGAGATCTTAGTGAAGAACTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007065.3-749s1c1
Sequence:CCGGCCAGACAATCGTCATGCAATTCTCGAGAATTGCATGACGATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007065.3-819s1c1
Sequence:CCGGCGGCAGTTCTTCACTAAGATTCTCGAGAATCTTAGTGAAGAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007065.3-671s1c1
Sequence:CCGGGACAGCCAATTACCTGGTCATCTCGAGATGACCAGGTAATTGGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007065
CDC37 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 37
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007065.3-1424s1c1
Sequence:CCGGGCCCATTCAAGTCTCTGCTTTCTCGAGAAAGCAGAGACTTGAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007065.3-818s1c1
Sequence:CCGGCCGGCAGTTCTTCACTAAGATCTCGAGATCTTAGTGAAGAACTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007065.3-749s1c1
Sequence:CCGGCCAGACAATCGTCATGCAATTCTCGAGAATTGCATGACGATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007065.3-819s1c1
Sequence:CCGGCGGCAGTTCTTCACTAAGATTCTCGAGAATCTTAGTGAAGAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007065.3-671s1c1
Sequence:CCGGGACAGCCAATTACCTGGTCATCTCGAGATGACCAGGTAATTGGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks