EMAIL THIS PAGE TO A FRIEND

CDC37L1

cell division cycle 37-like 1

110 Gene Product Result for
Synonyms: CDC37B HARC
UniProtKB ID: Q7L3B6, B1AL70, Q9NWS3, Q9NX16
Gene ID:
Human(55664) Summary: CDC37L1 is a cytoplasmic phosphoprotein that exists in complex with HSP90 (HSPCA; MIM 140571) as well as several other proteins involved in HSP90-mediated protein folding (Scholz et al., 2001 [PubMed 11413142]
Mouse(67072) cell division cycle 37-like 1
Rat(293886) cell division cycle 37-like 1
sheep(101112951) cell division cycle 37 homolog (S. cerevisiae)-like 1
domestic guinea pig(100720439) cell division cycle 37-like 1
naked mole-rat(101715986) cell division cycle 37-like 1
Zebrafish(569357) CDC37 cell division cycle 37 homolog (S. cerevisiae)-like 1
chicken(426535) cell division cycle 37 homolog (S. cerevisiae)-like 1
dog(476341) cell division cycle 37 homolog (S. cerevisiae)-like 1
cow(510572) cell division cycle 37 homolog (S. cerevisiae)-like 1
domestic cat(101099596) cell division cycle 37 homolog (S. cerevisiae)-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017913 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017913 Rosetta Predictions human pricing
NM_001011941 Rosetta Predictions rat pricing
XM_574650 Rosetta Predictions rat pricing
NM_025950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102395 predicted 1068
2 SASI_Hs01_00102397 predicted 1015
3 SASI_Hs01_00102398 predicted 781
4 SASI_Hs01_00102400 predicted 521
5 SASI_Hs01_00102401 predicted 1043
6 SASI_Hs02_00350893 predicted 333
7 SASI_Hs01_00102402 predicted 543
8 SASI_Hs01_00102403 predicted 532
9 SASI_Hs01_00102404 predicted 446
10 SASI_Hs02_00350894 predicted 541
11 SASI_Hs01_00102396 predicted 1116
12 SASI_Hs01_00102399 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120015 predicted 741
2 SASI_Rn01_00120016 predicted 891
3 SASI_Rn01_00120017 predicted 749
4 SASI_Rn01_00120018 predicted 657
5 SASI_Rn01_00120019 predicted 221
6 SASI_Rn01_00120021 predicted 1044
7 SASI_Rn01_00120022 predicted 323
8 SASI_Rn01_00120023 predicted 242
9 SASI_Rn01_00120024 predicted 312
10 SASI_Rn02_00199959 predicted 235
11 SASI_Rn01_00120020 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184056 predicted 908
2 SASI_Rn01_00184057 predicted 1065
3 SASI_Rn01_00184058 predicted 915
4 SASI_Rn01_00184059 predicted 836
5 SASI_Rn01_00184060 predicted 391
6 SASI_Rn01_00184061 predicted 578
7 SASI_Rn01_00184062 predicted 501
8 SASI_Rn01_00184063 predicted 409
9 SASI_Rn01_00184064 predicted 481
10 SASI_Rn01_00184065 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151139 predicted 1538
2 SASI_Mm01_00151140 predicted 840
3 SASI_Mm01_00151141 predicted 362
4 SASI_Mm01_00151142 predicted 485
5 SASI_Mm01_00151143 predicted 428
6 SASI_Mm01_00151144 predicted 509
7 SASI_Mm01_00151145 predicted 693
8 SASI_Mm01_00151146 predicted 1490
9 SASI_Mm01_00151147 predicted 1497
10 SASI_Mm01_00151148 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025950
VALIDATED
CDC37L1 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 37-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025950.2-882s21c1
Sequence:CCGGCCTGTGACAGTTCAGAATCATCTCGAGATGATTCTGAACTGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025950.2-429s21c1
Sequence:CCGGGATGCCATTAGCAAGGATGTTCTCGAGAACATCCTTGCTAATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025950.2-788s21c1
Sequence:CCGGAGCGGAGGAAGAAGGTTATTTCTCGAGAAATAACCTTCTTCCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025950.2-1536s21c1
Sequence:CCGGCCGCAGTGGTGACCTACTTTACTCGAGTAAAGTAGGTCACCACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025950.2-174s21c1
Sequence:CCGGCAGATGTATAGCCACGGGATTCTCGAGAATCCCGTGGCTATACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025950.1-2230s1c1
Sequence:CCGGCCCACTTCAATTTGTAGCAAACTCGAGTTTGCTACAAATTGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025950.1-700s1c1
Sequence:CCGGGCTGTGGTAATGCAGTTTATTCTCGAGAATAAACTGCATTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025950.1-175s1c1
Sequence:CCGGCAGATGTATAGCCACGGGATTCTCGAGAATCCCGTGGCTATACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025950.1-430s1c1
Sequence:CCGGGATGCCATTAGCAAGGATGTTCTCGAGAACATCCTTGCTAATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025950.1-883s1c1
Sequence:CCGGCCTGTGACAGTTCAGAATCATCTCGAGATGATTCTGAACTGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025950
VALIDATED
CDC37L1 MISSION shRNA shRNA Plasmid DNA
cell division cycle 37-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025950.2-882s21c1
Sequence:CCGGCCTGTGACAGTTCAGAATCATCTCGAGATGATTCTGAACTGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025950.2-429s21c1
Sequence:CCGGGATGCCATTAGCAAGGATGTTCTCGAGAACATCCTTGCTAATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025950.2-788s21c1
Sequence:CCGGAGCGGAGGAAGAAGGTTATTTCTCGAGAAATAACCTTCTTCCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025950.2-1536s21c1
Sequence:CCGGCCGCAGTGGTGACCTACTTTACTCGAGTAAAGTAGGTCACCACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025950.2-174s21c1
Sequence:CCGGCAGATGTATAGCCACGGGATTCTCGAGAATCCCGTGGCTATACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025950.1-2230s1c1
Sequence:CCGGCCCACTTCAATTTGTAGCAAACTCGAGTTTGCTACAAATTGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025950.1-700s1c1
Sequence:CCGGGCTGTGGTAATGCAGTTTATTCTCGAGAATAAACTGCATTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025950.1-175s1c1
Sequence:CCGGCAGATGTATAGCCACGGGATTCTCGAGAATCCCGTGGCTATACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025950.1-430s1c1
Sequence:CCGGGATGCCATTAGCAAGGATGTTCTCGAGAACATCCTTGCTAATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025950.1-883s1c1
Sequence:CCGGCCTGTGACAGTTCAGAATCATCTCGAGATGATTCTGAACTGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025950
VALIDATED
CDC37L1 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 37-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025950.2-882s21c1
Sequence:CCGGCCTGTGACAGTTCAGAATCATCTCGAGATGATTCTGAACTGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025950.2-429s21c1
Sequence:CCGGGATGCCATTAGCAAGGATGTTCTCGAGAACATCCTTGCTAATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025950.2-788s21c1
Sequence:CCGGAGCGGAGGAAGAAGGTTATTTCTCGAGAAATAACCTTCTTCCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025950.2-1536s21c1
Sequence:CCGGCCGCAGTGGTGACCTACTTTACTCGAGTAAAGTAGGTCACCACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025950.2-174s21c1
Sequence:CCGGCAGATGTATAGCCACGGGATTCTCGAGAATCCCGTGGCTATACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025950.1-2230s1c1
Sequence:CCGGCCCACTTCAATTTGTAGCAAACTCGAGTTTGCTACAAATTGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025950.1-700s1c1
Sequence:CCGGGCTGTGGTAATGCAGTTTATTCTCGAGAATAAACTGCATTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025950.1-175s1c1
Sequence:CCGGCAGATGTATAGCCACGGGATTCTCGAGAATCCCGTGGCTATACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025950.1-430s1c1
Sequence:CCGGGATGCCATTAGCAAGGATGTTCTCGAGAACATCCTTGCTAATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025950.1-883s1c1
Sequence:CCGGCCTGTGACAGTTCAGAATCATCTCGAGATGATTCTGAACTGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017913
VALIDATED
CDC37L1 MISSION shRNA Bacterial Glycerol Stock
cell division cycle 37-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017913.2-1076s1c1
Sequence:CCGGCCCATTCTGGTGTTGGATCTACTCGAGTAGATCCAACACCAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017913.2-339s1c1
Sequence:CCGGCCAGATGTATAGCCATGGAATCTCGAGATTCCATGGCTATACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_017913.2-868s1c1
Sequence:CCGGGCTGTTGTAATGCAGTTTATTCTCGAGAATAAACTGCATTACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017913.2-766s1c1
Sequence:CCGGCCATACCTTGTATGTGAAGAACTCGAGTTCTTCACATACAAGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017913.2-1437s1c1
Sequence:CCGGGCAGGAAGTCAAACTGGACTTCTCGAGAAGTCCAGTTTGACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017913
VALIDATED
CDC37L1 MISSION shRNA shRNA Plasmid DNA
cell division cycle 37-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017913.2-1076s1c1
Sequence:CCGGCCCATTCTGGTGTTGGATCTACTCGAGTAGATCCAACACCAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017913.2-339s1c1
Sequence:CCGGCCAGATGTATAGCCATGGAATCTCGAGATTCCATGGCTATACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_017913.2-868s1c1
Sequence:CCGGGCTGTTGTAATGCAGTTTATTCTCGAGAATAAACTGCATTACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017913.2-766s1c1
Sequence:CCGGCCATACCTTGTATGTGAAGAACTCGAGTTCTTCACATACAAGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017913.2-1437s1c1
Sequence:CCGGGCAGGAAGTCAAACTGGACTTCTCGAGAAGTCCAGTTTGACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017913
VALIDATED
CDC37L1 MISSION shRNA Lentiviral Transduction Particles
cell division cycle 37-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017913.2-1076s1c1
Sequence:CCGGCCCATTCTGGTGTTGGATCTACTCGAGTAGATCCAACACCAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017913.2-339s1c1
Sequence:CCGGCCAGATGTATAGCCATGGAATCTCGAGATTCCATGGCTATACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_017913.2-868s1c1
Sequence:CCGGGCTGTTGTAATGCAGTTTATTCTCGAGAATAAACTGCATTACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017913.2-766s1c1
Sequence:CCGGCCATACCTTGTATGTGAAGAACTCGAGTTCTTCACATACAAGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017913.2-1437s1c1
Sequence:CCGGGCAGGAAGTCAAACTGGACTTCTCGAGAAGTCCAGTTTGACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks